کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل


خرداد 1400
شن یک دو سه چهار پنج جم
 << < جاری> >>
1 2 3 4 5 6 7
8 9 10 11 12 13 14
15 16 17 18 19 20 21
22 23 24 25 26 27 28
29 30 31        


کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل



جستجو


آخرین مطالب


 



۳-۹-۷- ضریب همبستگی پیرسون
ضریب همبستگی یکی از معیارهای مورد استفاده در تعیین همبستگی دو متغیر میباشد و شدت رابطه و همچنین نوع رابطه (مستقیم یا معکوس) را نشان میدهد. این ضریب بین ۱ تا ۱- است و در صورت عدم وجود رابطه بین دو متغیر برابر صفر میباشد. ضریب همبستگی پیرسون، روشی پارامتری است و برای دادههایی با توزیع نرمال و یا تعداد داده های زیاد استفاده میشود. این ضریب از رابطه زیر محاسبه میشود (دانشگر، ۱۳۹۰)
آدرس سایت برای متن کامل پایان نامه ها
۳-۱۰- متغیرهای پژوهش
متغیر به عنوان یکی از عناصر اصلی پژوهش، به شکلهای مختلف و معیارهای متفاوت دستهبندی میشود. در این پژوهش بکارگیری فناوری اطلاعات به عنوان متغیر مستقل و هزینه های کیفیت به عنوان متغیر وابسته در نظر گرفته شده است.
۳-۱۱- قلمرو پژوهش (موضوعی، مکانی، زمانی)
قلمرو موضوعی
در این پژوهش به بررسی نقش و تاثیر بکارگیری فناوری اطلاعات بر هزینه های کیفیت پرداخته میشود. و به این مقوله میپردازیم که بکارگیری و کاربرد فناوری اطلاعات تا چه حد توانسته بر هزینه های کیفیت تاثیرگذار باشد. و همچنین هر یک از هزینه های کیفیت از دیدگاه رئیسان و معاونان شعب بانک مسکن شهر تهران در چه سطحی قرار دارد.
قلمرو مکانی
قلمرو مکانی پژوهش، شعب بانک مسکن موجود در شهر تهران میباشد.
قلمرو زمانی
مطالعات مقدماتی این پژوهش از اردیبهشت ماه ۱۳۹۳ آغاز گردید و این پژوهش در دی ماه همان سال پایان یافت.
فصل چهارم:
تحلیل داده ها
۴-۱- مقدمه
تجزیه و تحلیل داده ها فرآیندی چند مرحلهای است که طی آن دادههایی که از طریق بکارگیری ابزارهای جمعآوری در نمونه (جامعه) آماری فراهم آمدهاند و خلاصه، کدبندی، دستهبندی و… شدهاند، در نهایت پردازش میشوند تا زمینه برقراری انواع تحلیلها و ارتباطها بین این داده ها به منظور آزمون فرضیه ها فراهم آید. در این فرآیندها، داده ها هم از لحاظ مفهومی و هم از جنبه تجربی پالایش میشوند و تکنیکهای گوناگون آماری نقش بسزایی در استنباطها و تعمیمهای بعدی دارند (خاکی، ۱۳۸۷: ۳۲۵).
تجزیه و تحلیل اطلاعات به عنوان مرحلهای علمی از پایه های اساسی هر پژوهش علمی به شمار میرود که به وسیله آن کلیه فعالیتهای پژوهش تا رسیدن به نتیجه، کنترل و هدایت میشوند.
در این فصل نیز به توصیف داده های پژوهشی و تحلیل دادههایی که به وسیله پرسشنامه از افراد نمونه گردآوری شده‌اند پرداخته خواهد شد و سپس به هر یک از فرضیات پاسخ داده می‌شود.
۴-۲- توصیف ویژگیهای جمعیت شناختی اعضای نمونه
به منظور شناخت بهتر ماهیت جامعهای که در پژوهش مورد مطالعه قرار گرفته است و آشنایی بیشتر با متغیرهای پژوهش، قبل از تحلیل داده های آماری، لازم است این داده ها توصیف شود.
همچنین توصیف آماری داده ها، گامی در جهت تشخیص الگوی حاکم بر آنها و پایهای برای تبیین روابط بین متغیرهایی است که در پژوهش بکار میرود. بنابراین در این فصل ابتدا به توصیف آماری داده ها پرداخته میشود:
۴-۲-۱- جنسیت
جدول ۴-۱- توزیع فراوانی مربوط به جنسیت

جنسیت فراوانی درصد فراوانی
مرد ۱۷۸ ۶/۸۸
زن ۲۳ ۴/۱۱
جمع
موضوعات: بدون موضوع  لینک ثابت
[شنبه 1400-03-22] [ 02:53:00 ب.ظ ]




slVTG5’RACE-R3

 

 

معکوس

 

 

TTCCAACCACACCATTAGCA

 

 

۳۶۶ a

 

 

 

slβactin5’RACE-R1

 

 

معکوس

 

 

GGCACCTGAACCTCTCATTG

 

 

۸۶۷ b

 

 

 

slβactin5’RACE-R2

 

 

معکوس

 

 

GAGCTTCTCCTTGATGTCACG

 

 

۷۴۳ b

 

 

 

QPCR

 

 

slQVTG-F3

 

 

مستقیم

 

 

GAATGCACAAAGAGGGTCAAG

 

 

۶۳۰ a

 

 

 

slQVTG-R3

 

 

معکوس

 

 

TTGAAGGGTGAAAACTGATGC

 

 

۷۵۷ a

 

 

 

slQβactin-F3

 

 

مستقیم

 

 

CCTGTTCCAGCCATCCTTCT

 

 

۸۷۵ b

 

 

 

slQβactin-R3

 

 

معکوس

 

 

TGGTACCACCAGACAATACGG

 

 

۱۰۰۵ b

 

 

a موقعیت نسبت بهcDNA کامل ویتلوژنین درP. esfahani.
b موقعیت نسبت به cDNA کامل بتا-اکتین درP. esfahani.
۳-۹- مقایسات آماری
داده های آماری به صورت میانگین ± خطای استاندارد گزارش شدند. کلیه محاسبات آماری با بهره گرفتن از دو نرم افزار SPSS 19 و Microsoft Office Excel 2010 انجام شد. پس از اطمینان از توزیع نرمال داده ها و یکنواختی واریانس ها[۱۱۸] از آزمون تجزیه واریانس یک­طرفه[۱۱۹] برای مقایسه واریانس شاخص ­های موردنظر در هر ایستگاه و از آزمون چند دامنه دانکن[۱۲۰] در سطح ۰۵/۰ برای بررسی وجود یا عدم وجود اختلاف معنی­دار بین ایستگاه­ها استفاده شد. همچنین در هر ایستگاه برای مشخص کردن وجود یا عدم وجود انحراف نسبت جنسی از نسبت مورد انتظار، از آزمون مربع کای[۱۲۱] استفاده شد.
فصل چهارم
نتایج و بحث
۴-۱- شاخص ­های زیستی ماهیان صید شده
در این مطالعه در مجموع تعداد ۳۲۳ قطعه ماهی صید شد. از این تعداد، ۱۰۴ قطعه متعلق به ایستگاه چشمه­دیمه، ۸۱ قطعه متعلق به ایستگاه خرسونک، ۶۳ قطعه متعلق به ایستگاه چمگردان و ۷۵ عدد متعلق به ایستگاه پل صفائیه بود. دامنه سنی ماهیان در ایستگاه­ چشمه­دیمه ۱-۵ سال و در سه ایستگاه خرسونک، پل صفائیه و چمگردان ۳-۵ سال بود. تعداد ماهیان صید شده از هر ایستگاه به تفکیک جنسیت در جدول ۴-۱ مشاهده می­ شود.

در ماهیان صید شده از ایستگاه چشمه­دیمه، خرسونک، پل صفائیه و چمگردان میانگین وزنی به ترتیب ۳۱/۱ ± ۱۳/۱۸، ۳۴/۱ ± ۸۵/۲۵، ۱۳/۱ ± ۸۷/۴ و ۵۰/۰ ± ۷۶/۱۰ گرم و میانگین طولی به ترتیب ۳ ± ۱۰۷، ۲ ± ۱۱۸، ۴ ± ۶۹ و ۱ ± ۹۱ میلی­متر محاسبه شد (جدول ۴-۱). همان­طور که مشاهده می­ شود، اختلاف طول و وزن ماهیان در بین تمام ایستگاه­ها معنی­دار است (۰۵/۰p<). بیش­ترین و کم­ترین میزان میانگین طول و وزن ماهیان به ترتیب در ایستگاه­های خرسونک و چمگردان مشاهده شد.
جدول ۴-۱) ویژگی­های زیستی ماهیان صید شده در ایستگاه­های نمونه­برداری رودخانه زاینده­رود.

 

 
موضوعات: بدون موضوع  لینک ثابت
 [ 02:52:00 ب.ظ ]




بهمنی، نقیائی، علیمحمدی و دهخدا (۱۳۹۲) در مطالعهای باهدف بررسی نشانگان افت روحیه در زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و مقایسه آن با جمعیت عادی به این نتیجه رسیدند که تفاوت معناداری بین میانگین نشانگان افت روحیه زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و زنان سالم وجود دارد و میانگین نشانگان افت روحیه زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) (۲۲/۳۷) با توجه به نمره برش (۳۰<) میزان بالایی را به خود اختصاص داد.

بهمنی، نقیائی، علیمحمدی و دهخدا (۱۳۹۲) در مطالعهای با عنوان بررسی رابطه سه متغیر اضطراب وجودی، نشانگان افت روحیه و افسردگی در مادران کودکان مبتلا به بیماریهای بالقوه مهلک به این نتیجه رسیدند که بین سه متغیر رابطه معناداری وجود دارد، به طوری که اضطراب وجودی بالا پیش‌بینی کننده نشانگان افت روحیه بوده و درعین‌حال نشانگان افت روحیه بالا پیش‌بینی کننده افسردگی است.
تصویر مرتبط با افسردگی در روانشناسی Psychological depression
رحیمی و همکاران (۱۳۹۳) در مطالعهای تحت عنوان «اثربخشی مشاورهی شناختی معنویتمحور بر کاهش نشانگان افت روحیه سالمندان» به این نتیجه رسیده اند که رویکرد مشاورهی شناختی معنویتمحور میتواند در کاهش نشانگان افت روحیه سالمندان و حتی هر مشکل روحی و روانی دیگری که ریشه های وجودی، معنوی و شناختی دارد، موثر واقع شود.
مطالعات روان‌درمانی‌های انجام‌شده بر روی HIV:
روائی، حسینیان و صمدی (۱۳۸۵) به منظور بررسی تأثیر روان‌درمانی حمایتی بر بهبود کیفیت زندگی بیماران به این نتیجه رسیدند که رواندرمانی حمایتی بر بهبود کیفیت زندگی افراد مبتلا با توجه به عوامل کلی سلامت جسمانی و روانی تأثیر دارد.

سلگی، هاشمیان و سعیدی (۱۳۸۶) در مطالعه خود به بررسی تأثیر شناخت درمانی گروهی در کاهش افسردگی مردان مبتلا به HIV مثبت پرداختند نتایج آن‌ ها نشان داده بود که گروه درمانی شناختی میتواند یک روش موثری در کاهش افسردگی و افزایش کیفیت زندگی آن‌ ها باشد.
همچنین قزلسفلو و اثباتی (۱۳۹۰) در تحقیقی نشان دادند که گروه درمانی امید محور باعث بهبود کیفیت زندگی مردان مبتلا شده بود. حال با توجه به بیماری HIV و تبعاتی که برای بیمار به همراه دارد و کمبود پژوهشهای حاضر در مورد اثربخشی درمان روان‌شناختی بر افراد مبتلا به HIV مثبت پژوهشگر به دنبال آن برآمد تا با درمان روانشناختی موثر (شناخت درمانی هستینگر) بتواند به کاهش تبعات روانی –اجتماعی ذکرشده در زندگی بیماران بپردازد.
 تصویر درباره جامعه شناسی و علوم اجتماعی
رحمتی نجار کلائی و همکاران (۱۳۹۱) در مطالعهای تحت عنوان تجربیات بیماران مبتلا به ایدز از ننگ اجتماعی: یک مطالعه کیفی بیان کردند که اکثر بیماران بر مسئله فقدان درمان قطعی بیماری و ناامیدی به زندگی تأکید مینمودند و عاقبت خود را مرگ و نیستی میدانستند؛ به طوری که این ناامیدی روی کیفیت زندگی این افراد تأثیر نامطلوبی داشته و انتظار مرگ را در ذهن آن‌ ها مدام به تصویر میکشید همچنین بیماران این ناامیدی را از اثرات مهم این بیماری بر روی روحیه خود بیان کرده‌اند.
علیزاده و بهرامی (۱۳۹۱) در مطالعهای تحت عنوان بررسی تأثیر برنامه رفتاردرمانی عقلانی-هیجانی بر تاب آوری و سلامت روان زنان مبتلا به اچ.آی.وی/ایدز دارای سابقه سوء مصرف مواد و رفتارهای پرخطر جنسی به این نتیجه دست یافتند که آموزش مفاهیم رویکرد رفتاردرمانی عقلانی-هیجانی می‌تواند بر افزایش سطح تاب آوری و کاهش اضطراب و افسردگی زنان مبتلا به اچ.آی.وی/ایدز دارای سابقه سوء مصرف مواد و رفتارهای پرخطر جنسی موثر باشد.
در ایران پژوهش‌های متعددی در زمینه‌ی شناخت درمانی هستینگر صورت گرفته است که شامل:
بهمنی، اعتمادی, شفیع آبادی، دلاور و قنبری مطلق (١٣٨٩) در مطالعهای با عنوان مقایسه اثربخشی دو روش مداخله «شناختدرمانی آموزش محور به سبک مایکل فری» و «گروه درمانی شناختی/وجودگرا» بر امیدواری، عزت نفس و کیفیت زندگی زنانی که پس از شروع درمان سرطان غیر منتشر سینه، علائم افسردگی از خود بروز دادهاند، نشان داده است که میانگین افسردگی بعد از مداخله در گروه درمانی شناختی وجودگرا کمتر از شناختدرمانی آموزش محور است و افسردگی هر دو گروه نیز پایینتر از گروه گواه بوده و تفاوتها از نظر آماری معنادار است. در متغیر امیدواری نیز تأثیر روش گروه درمانی شناختی وجودگرا بر افزایش امیدواری بیشتر از روش شناختدرمانی آموزش محور و این تفاوت از لحاظ آماری معنادار بوده و هر دو گروه نیز میانگین بیشتری نسبت به گروه کنترل به دست آورده‌اند. در متغیر عزت نفس میانگین‌های دو گروه آزمایش با یکدیگر برابر اما با میانگین گروه کنترل تفاوت معنادار دارد. مقادیر میانگین نشان میدهد که عزت نفس در هر دو گروه نسبت به گروه گواه افزایش داشته و این تفاوت از نظر آماری معنیدار است. میانگین کیفیت زندگی در دو نوع مداخله شناختدرمانی آموزش محور و گروه درمانی شناختی وجودگرا با یکدیگر تفاوت نداشته اما نسبت به گروه کنترل بیشتر بوده است. این تفاوتها نیز به لحاظ آماری معنی‌دار است.
بهمنی، اسکندری، حسنی، دکانهای فرد و شفیع آبادی (۱۳۹۰) در مطالعه‌ای تحت عنوان « اثربخشی گروه درمانی شناختی وجودگرا بر افزایش امیدواری و کاهش افسردگی والدینی که فرزندانشان به دلیل ابتلا به سرطان تحت درمان‌های پزشکی قرار دارند» به این نتیجه رسیده است که گروه درمانی شناختی وجودگرا می‌تواند در افزایش امیدواری والدین فرزندان مبتلا به سرطان موثر باشد.
بهمنی، کرمانی رنجبر، قنبری مطلق و اسکندری (۱۳۹۱) در مطا
لعهای تحت عنوان« اثربخشی مداخله گروه درمانی شناختی وجودگرا بر بهبود کیفیت زندگی زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)» نشان داده است که این رویکرد باعث افزایش و بهبود کیفیت زندگی زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) شده است.
بهمنی، معتمد (۱۳۹۱) در مطالعه‌ای تحت عنوان « اثربخشی گروه درمانی شناختی- هستی نگر بر افزایش امیدواری در زنان مبتلا به همودیالیز» به این نتیجه رسیده است که میانگین امیدواری در گروه زنانی که در معرض مداخله گروه درمانی شناختی هستی نگر قرار گرفته‌اند به نحو بازر و معنی‌داری از گروهی که (گروه کنترل) در معرض این مداخله قرار نگرفته‌اند، افزایش یافته است.
۲-۶-۲ تحقیقات انجام‌شده در خارج از کشور:
بر خلاف مطالعات داخلی، مطالعات خارجی حاکی از آن است که بر روی متغیر وابسته پژوهش یعنی «نشانگان افت روحیه» پژوهش‌هایی صورت گرفته است، اما هیچ پژوهشی بر روی جمعیت افراد مبتلا به HIV انجام نشده است.
سورجیت ساهو[۱۸۲] (۲۰۰۹) در مقاله‌ی مروری خود تحت عنوان «متغیرهای نشانگان افت روحیه» عنوان می‌کند علی‌رغم شباهت آزردگی وجودی و نشانگان افت روحیه، متغیر نشانگان افت روحیه با علائمی چون ناتوانی در پیشبرد زندگی همراه است. البته نشانگان افت روحیه در افراد مبتلا به افسردگی ممکن است بروز کند. همچنین حس ناامیدی که جزء علائم اصلی این متغیر است می‌تواند منجر به ضعف فیزیکی و روانی فرد شده و به خودکشی و آرزوی مرگ رو آورد.
جاکوبسن[۱۸۳] (۲۰۰۷) در مطالعهی موردی تحت عنوان «بررسی نشانگان افت روحیه در حوزه‌ی درمان» به این نتیجه رسید که ١٠ تا ٢۵ درصد بیماران سرطانی از افسردگی رنج می‌برند. بعدها آشکار شد که این افسردگی عمده نیست و نشانگان افت روحیه است. هم چنانکه این وضع به عنوان یک حالت بی‌قراری توصیف شد که می‌تواند در پاسخ به شرایط خارجی تغییر یابد.
چنگ یانگ لی و همکاران[۱۸۴] (۲۰۱۱) در مطالعه‌ای توصیفی با عنوان «علائم نشانگان افت روحیه در میان بیماران سرطانی در تایوان» مطرح می‌کند که متغیر نشانگان افت روحیه با وضعیت اجتماعی اقتصادی، مشکلات روان‌شناختی، انواع گوناگون بیماری‌ها، سرطان و درمان‌ها مرتبط است.
رندی سانسون[۱۸۵] (۲۰۱۰) در مطالعهای تحت عنوان «نشانگان افت روحیه در افراد مبتلا به بیماریهای جسمانی» بیان نموده است که نشانگان افت روحیه حالت بی‌قراری چه در جمعیت بالینی چه در جمعیت روان‌پزشکی است و با حس عدم قدرت و پوچی مشخص می‌شود. به خاطر شیوع آن در یک سوم جمعیت بیمار گفته‌شده شناسایی این سندرم و انجام مداخلات ضروری ست.
بوسگالیا و کلارک[۱۸۶]،(۲۰۰۷) در مطالعهای با عنوان «حس انسجام به عنوان یک عامل نگه‌دارنده برای نشانگان افت روحیه در زنانی با تشخیص نهایی سرطان رحم» به این نتیجه رسیده است که حس انسجام می‌تواند در مقابل نشانگان افت روحیه حمایتگر باشد.
مطالعات انجام‌شده خارج از کشور در زمینه شناختدرمانی هستینگر:
لی می و ویلسون (٢٠٠٨) در مطالعه مروری مداخلات مرتبط با درمان آزردگی وجودی در ارتباط با بیماری‌های تهدیدکننده زندگی، نشان دادند که هدف کلی مداخلاتی مثل گروه درمانی حمایتی-بیانگر[۱۸۷]، گروه درمانی شناختی-وجودی، روان‌درمانی گروهی متمرکز بر معنا[۱۸۸] و مداخلات معنا محور[۱۸۹] و غیره ایجاد فضایی حمایتی برای کمک به آن‌ ها جهت سازگاری با نیازهای بیماری و ارتقای کیفیت زندگی‌شان و مقابله با منابع فشار روانی ناشی از سرطان و یافتن معنای شخصی‌شان و پاسخ به سؤالات وجودی بیماران مبتلا بوده است و علی‌رغم وجود برخی محدودیت‌ها تا حدودی در تخفیف آلام وجودی این بیماران موثر بوده‌اند لیکن تنها به نیازهای بیماران پرداخته‌اند.
کیسان، بلاچ، اسمیت، کلارک، میاچ، اِکین، رنجری و اسنایدر (۲۰۰۳) در مطالعه‌ای تحت عنوان«اثربخشی روش گروه درمانی شناختی وجود گرا بر بهبود وضعیت خلق و نگرش ذهنی زنان مبتلا به مراحل غیر منتشر سرطان که مشغول دریافت شیمی‌درمانی بودند» به این نتیجه رسیدند که شیوه گروه درمانی وجودگرا باعث کاهش اضطراب و افسردگی و بهتر شدن روابط خانوادگی بیماران شد و در مجموع این روش را مفید ارزیابی کردند.
بریتبارت (۲۰۰۳) در مطالعهای تحت عنوان اثربخشی گروه درمانی وجودی در مداخلات درمانی افراد مبتلا به سرطان بیان کرد؛ در گروههایی که افراد درگیر بیماریهای مزمن میگردند، به مرور زمان معنا و امید خود را از دست داده و دچار افسردگی میگردند. لذا درمانهای وجودی برای کاهش افسردگی و افزایش امید این دسته از بیماران یکی از مناسبترین شیوه های درمانی است.
مطالعات رواندرمانی انجام‌شده در خارج از کشور:
اسکویلی [۱۹۰]و همکاران (۲۰۱۲) در مطالعه‌ای تأثیر امید در سلامتی بیماران مبتلا به ایدز را مورد بررسی قرار دارند . آن‌ ها با بهره گرفتن از مقیاس خود گزارشی بعلاوهی آزمایش نمونه خون بیماران مبتلا به ایدز، میزان سلامتی آن‌ ها را پس از امید درمانی ارزیابی کرده و به این نتیجه رسیدند که افزایش امید منجر به افزایش سلامتی در این بیماران می‌گردد.
بلیر[۱۹۱](۲۰۰۴) در تحقیقی تحت عنوان بررسی تأثیر امیدواری در گروه درمانی نشان داد که امیدواری که نوعی احساس امکان‌پذیر بود، یک رویداد یا رفتار مطلوب در آینده است، عامل مهم در روان‌درمانگری فردی و گروه درمانی به حساب می‌آید.< br />فصل سوم
روش تحقیق
۳-۱ مقدمه
در این فصل نوع مطالعه، جامعه مورد بررسی، ملاکهای انتخاب شرکت‌کنندگان در پژوهش، حجم نمونه و روش محاسبه آن، متغیرهای پژوهش و نحوه سنجش آن‌ ها، روش جمع‌ آوری داده ها و تجزیه و تحلیل آن‌ ها، شیوه انجام کار و ملاحظات اخلاقی به تفضیل مطرح شده است. همچنین سرفصل محتوای جلسات درمانی در انتهای فصل به اختصار بیان شده است.
۳-۲ روش مطالعه
در این پژوهش از طرح تک موردی[۱۹۲]استفاده شده است. یک آزمایش تک موردی که گاهی آن را آزمایش تک آزمودنی[۱۹۳] یا آزمایش سریهای زمانی[۱۹۴] نامیده‌اند، آزمایشی است که مشتمل بر تحقیق فشرده بر روی یک فرد یا تعدادی از افراد است که به عنوان یک گروه واحد در نظر گرفته میشوند. همان طور که توماس کراتوچویل توضیح داده است، طرحهای تک موردی «مشتمل بر تحلیل فشرده در ارگانیزم های واحد» است. آزمایشهای تک موردی به خوبی متناسب با پژوهشهای اصلاح رفتار است که در مشاوره، روان‌درمانی، مراقبتهای درمانگاهی و پژوهشهای مربوط به مواد مخدر به وفور یافت میشود (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
آزمایشهای تک موردی را نباید با پژوهش موردی[۱۹۵] معادل دانست. هرچند هر دو به مورد معطوف‌اند، ولی از نظر طرح و هدف با یکدیگر تفاوت زیادی دارند. پژوهشهای موردی به یک عمل آزمایشی وسیعتر (معمولاً یک برنامه به مقیاس بزرگ) میپردازد که در یک موقعیت میدانی اجراشده و به شدت بر داده‌های کیفی تکیه دارد (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
در این مطالعه از طرح AB که مبنای طرحهای تک آزمودنی است، استفاده شد. پژوهشگر این طرح را از طریق انتخاب یک شرکت‌کننده برای آزمایش، یک یا چند رفتار هدف، اندازه های رفتارهای هدف و یک عمل آزمایشی شروع میکند. سپس رفتار هدف به طور مکرر در خلال دوره خط پایه اندازه گیری میشود (A). سرانجام عمل آزمایشی (B) هنگامی که پژوهشگر به اندازه گیری رفتار هدف ادامه میدهد، اجرا میگردد.
اگر تفاوت بین میانگین اندازهگیریهای A و B از نظر آماری معنادار باشد، میتوانیم نتیجه بگیریم که یک تغییر پایا از مرحله خط پایه تا مرحله عمل اتفاق افتاده است. این طرح فقط باید هنگامی مورد استفاده قرار گیرد که هیچ جانشین مناسبی موجود نباشد یا اینکه پژوهشگر آن را به عنوان یک مطالعه مقدماتی انجام دهد تا به دنبال آن آزمایشی با طرحی دقیقتر اجرا کند (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
به عنوان یک قاعده کلی، در هر مرحله از یک طرح تک موردی باید طول و تعداد اندازه گیری‌ها تقریباً مساوی باشد، در غیر این صورت، عدم تعادل، تحلیل آماری و تفسیر اثرهای عمل آزمایشی را پیچیده میکند (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶). با وجود محدودیتهای این طرح در مقایسه با بقیه طرحها، از تاریخچه های موردی غیرآزمایشی درباره اثرات درمان، شواهد بهتری ارائه میکند (بیابان‌گرد،١٣٨۶).

موضوعات: بدون موضوع  لینک ثابت
 [ 02:52:00 ب.ظ ]




فقر :
اول: وجود نیاز ضروری . این معنا همه انسانها را تا زمانیکه در دنیا هستند و بلکه تمام موجودات را شامل میشود . به همین معناست آیه «الا ای مردم شما نیازمند خدایید و خدا بی نیاز و ستوده است »
تحقیق - متن کامل - پایان نامه

دوم: تهیدستی که در این ایات فقر به این معناست :« این صدقات برای ان نیازمندانی است که در راه خدا فرو مانده اند …از شدت خویشتنداری فرد بی اطلاع انان را توانگر می پندارد » و « صدقات در حقیقت از ان نیازمندان ومستمندان است »
سوم : فقر نفس که عبارت است از ازمندی و سیری ناپذیری .
چهارم : فقر و نیازمندی به خدا .همچنان که در ایه «پروردگارا به انچه از خیر و خوبی بر من نازل کرده ای نیازمندم» مقصود همین معنا از فقر است.[۱۴]
سلامت روان : به معنی رفتار موزون و هماهنگ با جامعه ، شناخت و پذیرش واقعیتهای اجتماعی و قدرت سازگاری با آنها، ارضاء نیازهای خویشتن به طور متعادل و شکوفایی استعدادهای فطری خویش می باشد.۲[۱۵]
 تصویر درباره جامعه شناسی و علوم اجتماعی
۱-۷- پیشینه تحقیق:
دربخش کتاب :
۱-کتاب فقر، نابرابری درآمدی و مولفه های سرمایه انسانی ازدیدگاه اسلام
این تحقیق دردو بخش نظری و تجربی تدوین شده است. بخش اول شامل فقر، نابرابری درآمدی و مولفه های سرمایه انسانی دراسلام است که به بررسی فقرازدیدگاه اسلام ، انواع فقر،علائم آن، علل و عوامل فقردرآیات و روایات،آثارآن ،عوامل موثربرفقرو راهکارهای مقابله با آن می پردازد. درفصل دوم به واژه نابرابری در آیات و روایات وازدیدگاه متفکران اسلامی پرداخته می شود. درفصل سوم به جایگاه و اهمیت دانش در آیات و روایات و اهمیت بهداشت اشاره می کند و درفصل چهارم کار و تلاش دراسلام را مورد بررسی قرارمی دهد و ازبیکاری به عنوان یکی ازعوامل فقر یاد می کند. دربخش دوم به بررسی فقرو نابرابری و مولفه های سرمایه انسانی درکشورهای اسلامی می پردازد وچشم اندازی کلی دارد بروضعیت گروه کشورهای اسلامی، ساختار اقتصادی آنها، تولید و رشد و تورم وسرمایه گذاری و درپایان هم مروری مختصربرادبیات پژوهش دراقتصاد متعارف دارد.این کتاب کاریست ازحسین میسمی بامقدمه دکترصادق بختیاری استاد اقتصاد دانشگاه امام صادق (علیه السلام) که در سال ۱۳۸۸ به چاپ رسیده است.
عکس مرتبط با اقتصاد
۲- کتاب پدیده شناسی فقر و توسعه دربرگیرنده مقالات مختلف دراین زمینه است که درچهارجلد به کوشش دفترتبلیغات اسلامی استان خراسان درسال۱۳۸۰ به چاپ رسیده است. دراین مجموعه ابتدا هریک ازمسائل فقرو توسعه درقالب یک مقاله ازدیدگاه اقتصاد متداول مورد بررسی قرارگرفته است و سپس مقاله ای نگارش یافته که دیدگاه دین را درهمان مورد بررسی کرده است.شیوه نگارش مقالات اسلامی نیز به دو صورت متن و پانویس است که نخست مطلب درمتن به صورت قانونمند و فشرده آمده است وسپس درپانویس نمونه هایی از آیات و احادیث وارد شده است.
دربخش مقالات و پایان نامه ها :
۱- بررسی عوامل فقروشیوه های مبارزه با آن ازدیدگاه قرآن ومتون اسلامی عنوان پایان نامه زهره مولایی دررشته تاریخ و فلسفه است که درسال ۱۳۹۰ دفاع شده است.
هدف دراین پژوهش بررسی عوامل فقروشیوه های مبارزه با آن ازدیدگاه قرآن ومتون اسلامی بوده است. این پژوهش ازنوع بنیادی بوده و ازطریق بررسی واستفاده ازمنابع اصیل اسلامی (قرآن واحادیث) صورت پذیرفته است. روش پژوهش توصیفی – تحلیلی بوده و بدین وسیله عوامل تاثیرگذاردرتوسعه فقرو شیوه ها و راهکارهای زدایش این معضل اجتماعی با نگرش اسلامی مورد بررسی دقیق قرار گرفت. با توجه به این که فقریک پدیده نامطلوب اجتماعی است و گستره آن درجامعه به پیامدهای زیانبارهمه جانبه ای درکوتاه مدت و بلند مدت همراه می باشد،بدین خاطر مورد نکوهش همه ادیان وفرهنگهای بشری به ویژه دین مبین اسلام واقع شده است. دراین تحقیق با برسی فرهنگ غنی و پربار اسلامی نخست به شناسایی مفهوم فقرومشتقات آن درآیات و احادیث پرداخته و انواع فقرو دیدگاه های مختلف پیرامون آن مورد بررسی قرار گرفت و به دنبال آن به بررسی عوامل تاثیرگذار بر توسعه فقر در ابعاد اجتماعی، اقتصادی، سیاسی و فرهنگی پرداخته شده است. در پایان شیوه های مبارزه با فقر با استناد به متون اسلامی بررسی گردیده و نتایج نشان داده است که پرداخت خمس، زکات، مالیات، صدقه، قرض و…. از جمله شیوه های مناسب برای مبارزه با این بلای خانمان سوزدرزمینه فردی و اجتماعی می باشد.
۲- فقرو بهداشت روانی ازدیدگاه دین و روانشناسی ازسید مهدی موسوی اصل- فصلنامه روانشناسی ودین –شماره ۴ – ۱۳۸۷
این مقاله، به پیامدهای گوناگون جسمی، فرهنگی ـ اجتماعی و روانی فقر بر بهداشت روانی می پردازد. فقر فرهنگی، انزوا، پرخاشگری، ضعف اخلاقی و دینی، کاهش عزت نفس، اضطراب و اختلالات روانی از جمله این آثار مخربند. رویکرد متون اسلامی به مسائل فقر و به معانی گوناگون آن در منابع دینی دیگر مباحث این مقاله است، دلائل عدم مطلوبیت فقر در این منابع عبارتند از: تضاد فقر با عدالت اجتماعی، پناه بردن به خداوند از فقر در ادعیه امامان معصوم، اهمیت دین برای انسجام اسلامی در جامعه، برنامه دین برای اهداف متعالی و عواقب نامطلوب فقر از منظر دین. سرانجام، توضیح و
تبیین مواردی که موهم این برداشت است که اسلام با مسئله فقرمخالفتی ندارد،بلکه آنراتاییدمیکند.
۳- مفهوم فقر از دیدگاه دین و دانش نوین و پیامدها و شیوه های رویارویی با آن ازدکتر سید محمود طباطبایی درفصلنامه مطالعات اسلامی ، شماره ۵۰، پاییز و زمستان ۱۳۷۹
فقر یک پدیده نامطلوب اجتماعی است که وجود و گستردگی دامنه آن در جامعه به پیآمدهای زیان آور همه جانبه ای در کوتاه مدت و درازمدت می انجامد. این پدیده شوم در همه ادیان و فرهنگهای بشری نکوهش، برای زدودن آن از جامعه راه ها و روش های گوناگونی پیشنهاد شده است.
با یک نگرش عمیق در فرهنگ غنی و پربار اسلامی نخست به شناسایی مفهوم فقر پرداخته ، پس از آن به ارزیابی مصادیق فقر در جامعه ایران اسلامی- می پردازد، سپس پیآمدها و راه های زدودن یامقابله با آن خواهیم پرداخت.

۴- بررسی مفهوم فقر از منظر قرآن و روایات ائمه اطهارازحسین غفورزاده و محمدمهدی عسگری
سال سوم، شماره اول -۱۳۸۸ – تخصصی مطالعات قرآن و حدیث.فصلنامۀ علمی در
فقر یک پدیده نامطلوب اجتماعی است که وجود و گستردگی دامنه آن در جامعه به پیآمدهای زیان آور همه جانبه ای در کوتاه مدت و دراز مدت می انجامد .
این پدیده شوم درهمه ادیان و فرهنگ های بشری نکوهش و برای زدودن آن از جامعه راه ها و روش های گوناگونی پیشنهاد شده است. در قرآن کریم و روایات متعددی نیز، فقر به عنوان عامل منفی در زندگی انسان معرفی شده است که باید به زودی رفع گردد.اما در مقابل، در برخی از روایات عباراتی پیرامون ستایش فقر و جایگاه فقرا نزد خداوند دیده می شود که ایجاد یک نوع تعارضی در این زمینه می نماید.
لذا حل تعارض روایات و تبیین موضع اسلام و شیوه مواجهه آن با مقوله فقر ضرورتی انکار ناپذیر است.
بررسی منابع اسلامی نیز مشخص می کند، مقتضای جمع وسازش میان اخبار متعارض این است که فقر و ثروت هر یک به نوبه خود نعمتی الهی است که بنده وظیفه دارد به مقتضای آن عمل کند و به همین دلیل دربیشتر دعاهای حضرات معصومین (علیه السلام)کفاف خواسته شده که سالمتر و کم خطرتر از طرفین آن است علاوه بر این، مقاله حاضر پدیده فقر را با استمداد از منابع تفسیری و فقهی مورد بررسی قرار داده است وجامعیت و نگاه دقیق به مسئله فقر و اقسام آن از جمله نوآوری این تحقیق است.
۵- طباطبایی(۱۳۷۹)نیز در مقاله خویش نخست، به شناسایی مفهوم فقر در فرهنگ اسلامی پرداخته، پس از آن به ارزیابی مصادیق فقر در جامعه ایران اسلامی و سپس پیآمدها و را ههای زدودن یا مقابله با آن پرداخته است.با مطالعه این آثار و دیگر آثار مرتبط، به خوبی وجه تمایز تحقیق حاضر با دیگرپژوهش ها روشن می شود.دراین اثر به صورت جامع به بررسی آیات قرآن و روایات معصومین (علیهم السلام)در مورد مفهوم فقر و اقسام آن وهمچنین حل تعارض روایات در مورد مدح و ذم فقر در اسلام پرداخته شده است و جنبه های دیگر مسئله نظیر مقایسه مفاهیم فقر و مسکنت با دو مفهوم فقر مطلق و نسبی و یا روش استنباط آنها از قرآن و حدیث اشاره شده است.
۱-۸- جمع بندی و نتیجه گیری
فصل دوم:
مفهوم فقر و انواع فقر
۲-۱- مفهوم فقر
۲-۱-۱- فقر از دیدگاه اهل لغت
فقر به معنای کندن ،حفر کردن ،فرود امدن حادثه بر کسی و شکستن پشت او ،پشت شکستن و درویشی است .گاه از فقر ،معنی فاقد بودن عموم مایحتاج حیات اراده میشود و به این معنی همه موجودات جز ذات اقدس الهی فقیرند که هرکس و هر چیز در افاضه فیض به باری تعالی عزاسمه نیازمند می باشد . غنی الذات تنها خداوند است و گاه فقر به نداشتن مال مراد باشد که برخی احادیث در ذم و نکوهش آن آمده و برخی احادیث در مدح وستایش آن . آری اگر فقر با صفاتی چون رضا و قناعت توام باشد فقیر به فقر و نداری خود راضی باشد و براین باور است که خدای مهربان این وضع را برای او پسندیده است .ولی اگر فقر بر فردی خام و بی مایه از معرفت به خدا درآید باری گران و آزمایشی بس خطرناک است که وی را به عیوبی چون ضعف نفس و حسد وغیبت و دروغ و دزدی و خیانت دچارسازد و چه بسا ناتوانی او از کشش این بار گران وی را به کفر کشاند[۱۶].
مرحوم نراقی در تعریف فقرمی فرماید: فقر ضد غناست و آن عبارت است ازموجود نبودن آن چیزهایی که در زندگی به آنها نیاز بوده باشد.[۱۷]
آیت الله مکارم شیرازی دراین باره چنین می نویسند: فقر عبارت است از فقدان یا کسری درآمد به نحوی که شخص مبتلا به این حالت مخارج شرعی و عرفی اش بیش از درآمد او باشد. به عبارت دیگرکسی است که مخارج سال خود و عیالاتش (زن و فرزندان و تحت تکلفش) را ندارد.[۱۸]
فقر در لغت نامه دهخدا چنین تعریف شده است: فقرنداشتن مایحتاج است و تفاوت آن با فقد این است که فقد نداشتن چیزی است که بدان نیازی نباشد و آن را فقر نتوان گفت. بنابراین فقرا مردم مسکین و بی چیز را گویند، کسانی که حرفه ای ندارندیا صاحبان حرفه که حرفه آنها زندگیشان را کفایت نکند.[۱۹]
خلیل بن احمد میگوید: «اَلْفَقْرُ فِى النَفسِ لا فِى الْمالِ تَعْرِفُهُ- وَ مِثْلَ ذاکَ الغنَى فِى النّفْسِ لا الْمال- یعنى فقر و نیازمندى حقیقى فقر نفسانى است نه فقر مالى که تو آنرا می شناسى، و هم چنین بى‏نیازى همان بى‏نیازى نفسانى یا عزت نفس و بزرگوارى است نه بى‏نیازى از جهت مال و ثروت.[۲۰]
در قاموس فقر بدین معنا امده است:
فقر: حاجت. فَقِیر: حاجتمند واحتیاج را از آن جهت فقر گفته‏اند که آن بمنزله شکسته شدن فقار ظهر (ستون فقرات) است در تعذّر رسیدن بمراد (مجمع).
ناگفته نماند: حاجت یکدفعه حاجت ذاتى است مثل‏ یا أَیهَا النَّاسُ أَنْتُمُ‏ الْفُقَراءُ إِلَى اللَّهِ وَ اللَّهُ هُوَ الْغَنِی الْحَمِیدُ اى مردم شما بخدا محتاجید و خدا اوست بى‏نیاز ستوده[۲۱]. این شامل حال همه است حتى میلیاردرها،و یک دفعه بمعنى نادارى و بى‏چیزى است مثل‏:« وَ مَنْ کانَ‏ فَقِیراً فَلْیأْکُلْ بِالْمَعْرُوفِ‏»[۲۲]
فاقِرَه‏: داهیه بزرگ. این از آنست که بلاى بزرگ پشت انسان را میشکند وَ وُجُوهٌ یوْمَئِذٍ باسِرَهٌ. تَظُنُّ أَنْ یفْعَلَ بِها فاقِرَهٌ.چهره‏هائى در آنروز درهم کشیده است توقّع دارد که بلائى کمرشکن بسرش آید.[۲۳] [۲۴]
ابن فارس درباره معنای فقر می گوید: فقر:الفاء و القاف و الراء: أصل صحیح یدل على انفراج فی شی‏ء م
ن عضو أو غیر ذلک، من ذلک الفقار للظهر، الواحده فقاره، سمّیت للحزوز و الفصول الّتى بینها. و الفقیر: المکسور فقار الظهر من ذلّته و مسکنته. و من ذلک فقرتهم الفاقره، و هی الداهیه، کأنّها کاسره لفقار الظهر. و بعض أهل العلم یقولون: الفقیر: الّذى له بلغه من عیش. و أمّا الفقیر: فانّه مخرج الماء من القناه، و قیاسه صحیح، لأنّه هزم فی الأرض و کسر .[۲۵]
ابن فارس می گوید: فقر عبارت است از: فاء و قاف و راء که اصل صحیح کلمه است و دلالت می کند بر گشایش در چیزیکه از عضو بدن باشد یا غیر آن و از این جهت «فقار اظهر» گودی پشت است و مفرد آن فقاره می باشدکه برای شکاف و گشایش در ستون فقرات است و فقیر به معنی شکسته شدن .و اهل لغت می گویند فقیر کسی است که آرزوی رسیدن به زندگی خوب را دارد و فقیر جایی است که آب خارج می شود از قنات و سنجیدن این نیز درست است . برای اینکه در زمین شکستی ایجاد شده و خرابی بوجود آمده است.
در جایی دیگر نیز فقر بدین معنا آمده است:
الفقر و الفقر: ضدّ الغنى، مثل الضعف و الضعف. و رجل فقیر من المال، و قد فقر فهو فقیر، و الجمع فقراء، و الأنثى فقیره من نسوه فقائر. و الفقیر:الّذى له ما یأکل، و المسکین الّذى لا شی‏ء له. و الفقره و الفقره و الفقاره واحده فقار الظهر، و هو ما انتضد من عظام الصلب من لدن الکاهل الى العجب .[۲۶]
۲-۱-۲- فقر از دیدگاه اصطلاحی :
راغب اصفهانی می گوید فقر به چهار معنابه کار می رود:
اول: وجود نیاز ضروری . این معنا همه انسانها را تا زمانی که در دنیا هستند و بلکه تمام موجودات را شامل می شود . به همین معناست آیه « ای مردم شما نیازمند خدایید و خدا بی نیاز و ستوده است »
دوم: تهیدستی که در این ایات فقر به این معناست :« این صدقات برای ان نیازمندانی است که در راه خدا فرومانده اند …از شدت خویشتنداری فرد بی اطلاع آنان را توانگر می پندارد » و « صدقات در حقیقت ازآن نیازمندان ومستمندان است »
سوم : فقر نفس که عبارت است ازآزمندی و سیری ناپذیری .
چهارم : فقر و نیازمندی به خدا .همچنان که درآیه «پروردگارا به آنچه از خیر و خوبی بر من نازل کرده ای نیازمندم» مقصود همین معنا از فقر است.[۲۷]
فقر عبارت است از نیازمندی انسان یا بی نصیب ماندن از چیزهایی که برای تامین زندگی او وکسانی که تحت تکفل او هستند کفایت می کند . به عبارتی دقیقتر :فقر عبارت است از نداشتن چیزهایی که آدمی در زندگی به آنها نیازمند است و ناقص یا اندک بودن امکاناتی که شکوفایی قابلیت آدمی ظهور استعدادهای او به آنها بستگی دارد .[۲۸]
امام محمد غزالی درتعریف فقر چنین می گوید: بدان که فقر عبارت است از نیستی آنچه بدان حاجت باشد. اگر آنچه بدان حاجت افتد موجود باشد و برآن قدرت بوده محتاج فقیر نباشد و چون این فهم کردی شک نداری درآنچه هر موجودی جز حق تعالی فقیر است زیرا که محتاج است به دوام وجود و دوام وجود او از فضل باریتعالی است و این است معنی فقر مطلق. ۱
خواجه عبدالله انصاری می گوید: بدان که فقر دو است : یکی آن که رسول خدا از آن استعاذت کرد و گفت « اَعوذُ بِکَ مِنَ الْفَقْرِ»و دیگر آن که فرمود :« اَلْفَقْرُ فَخْری». آن یکی نزدیک کفر است واین یکی نزدیک حق. اما آن که به کفر نزدیک است فقر دل است که علم و حکمت و اخلاق و صبر و رضا و تسلیم وتوکل از دل ببرد.اما آن فقر که گفت الفقر فخری آن است که مرد از دنیا برهنه گردد و در این برهنگی به دین نزدیک گردد.۲
در قرآن فقر با تعبیرات گوناگونی مطرح گشته است:
۱-سیئه؛ گناه زشت: به فقر تفسیر شده است.« ََو بَلَونَهُم بِالحَسَناتِ وَ الَّسیئاتِ» ۱و آنها را به خوبیها و بدیها بیازمودیم.درتفسیر علی بن ابراهیم قمی آمده است : یعنی« بِالسِعهِ وَ الْاَمْنِ وَ الْفَقْرِ وَ الْفاقَهِ الشِدَّهِ » (آزمودیم) با فراخی و امنیت و فقر و بینوایی و سختی.
۱-غزالی ،کیمیای سعادت ،ج۲، ص۴۲۵-
۲- انصاری ، عبدالله بن محمد ،منازل السائرین،
۳ -اعراف ۱۶۸ ،مترجمان ،ترجمه مجمع البیان فی تفسیر القران ،ج۱۰ ،ص۱۰۰
از امام صادق علیه السلام نقل شده است که گفته اند: « حسنات» در کتاب خدا دو قسم است و «سیئات» نیز دو قسم است: از جمله حسناتی که خدا ذکر کرده است : سلامتی، امنیت ، فراخی در زندگی و رزق و روزی است . اینها را خداوند حسنات و نیکیها نامیده است و منظور از سیئه و بدی در اینجا بیماری و ترس و گرسنگی و سختی هاست.
۲- مسکنت : بیچارگی ؛ «وَ ضُرِبَت عَلَیهِمُ المَسکَنَهُ »۱، بر ایشان مهربیچارگی و فروماندگی زده شد.در تفسیر قمی این آیه نیز به جوع و گرسنگی تعبیر شده است.
۳-قتر: سختی و تنگدستی؛« وَلَا یرهَقُ وُجُوهَهُم قَتَرُُ وَ لَا ذِلَّهٌ»۲سختی و تنگدستی و زبونی چهره شان را نمی پوشاند.
۴-سوء : بدی و زشتی:«وَلَو کُنتُ أَعلَمُ الغَیبَ لَاستَکثَرتُ مِنَ الخَیرِ وَ مَا مسَّنِی السُّوءُ»۳اگرغیب می دانستم سود بسیار می بردم و بدی به من نمی رسید. امام باقر علیه السلام سوء را دراین آیه به « فقر » تفسیر کردند.۴
۱-آل عمران ۱۱۲،شریف لاهیجی ،محمدبن علی ،تفسیر شریف لاهیجی ،ج۱ ،ص۳۶۷
۲-یونس ،۲۶ ،قمی ،علی بن ابراهیم، تفسیرقمی ،ج۱،ص۳۱۱
۳-اعراف ،۱۸۸ ،سیوطی ،جلال الدین،الدر المنثور فی تفسیر الماثور،ج۳ ،ص۱۵۱

 

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:52:00 ب.ظ ]




    • – هم : قصد کرد . ↑
    • – آن زن از فرط اشتیاق و میل به وصال یوسف اهتمام و اصرار می کرد . و اگر لطف خاص پروردگار و برهان مشهود خدا نبود ، یوسف ( به قتل آن زن ، به جهت درخواست گناه کبیره ) اهتمام می کرد . ولی ما یوسف را از ارتکاب عمل زشت منصرف نمودیم ، زیرا که او از بندگان معصوم خالص شده ما است . ↑
    • – چون زن عزیز ، مکر و ملامت زنان شهر را شنید ، آن ها را دعوت کرد و مجلسی بیاراست ، و برای ایشان تکیه گاهی فراهم ساخت ، و برای هر یک نفر ایشان کاردی و ترنجی آماده نمود . به یوسف که در کمال آراستگی و زیبایی بود ، دستور داد به مجلس درآید . چون بانوان مصری او را دیدند ، در جمال او خیره شدند ، و او را بزرگ دیدند . و چنان از خود بی خود شدند که به جای ترنج ، دست های خود را بریدند و گفتند : تبارک الله ! این پسر بشر نیست ، بلکه او فرشته بزرگواری است . ↑

دانلود پایان نامه

  • – براء : بی گناه . ↑
  • – با آن که دلایل پاکدامنی و بی گناهی یوسف را دیدند ، باز چنین صلاح دیدند که او را برای مدتی زندانی کنند . ↑
  • – همراه با یوسف ، دو جوان دیگر هم به زندان افتادند . به یوسف گفتند : یکی از ما خواب دیده که برای شراب ، انگور می افشرم. و دیگری گفت : من در خواب دیده ام که طبقی از نان روی سرم می برم ، و مرغ های هوا از آن نان می خورند. چون تو را از نیکوکاران و دانشمندان می بینم ، از تعبیر این خواب ها ما را آگاه کن . ↑
  • – قلد : آویزان کردن . ↑
  • – وشاح : زینت . ↑
  • – اصفاد : ج صفد : غل و زنجیر. ↑
  • – روزی پادشاه گفت : من در خواب دیدم که هفت گاو فربه را هفت گاو لاغر خوردند . و هفت خوشه سبز را هفت خوشه خشک شده نابود کردند .ای بزرگان ! این خواب و رویای مرا تعبیر کنید ، اگر علم تعبیر خواب را دارید . ↑
  • – شاه گفت : او را نزد من بیاورید . فرستاده شاه نزد یوسف آمد . یوسف به او گفت : نزد شاه برگرد ، و بپرس که چه شد زنان مصر دست های خود را بُریدند . البته پروردگار من ، از مکر و حیله آن ها آگاه است . ↑
  • – حصص : آشکار شد . ↑
  • – قد : پاره شد . ↑
  • – أخُون بالغیب : در نهان خیانت کنم . ↑
  • – لوم : سرزنش ↑
  • – شاه به زنان مصر گفت : حقیقت حال خود را که با یوسف مراوده داشتید ، بگوئید . گفتند : حاش لله! ما از او بدی و سوء قصدی نمی دانیم . همسر عزیز گفت : اکنون حق آشکار گردید . و من شخصاً میل داشتم که با یوسف مراوده کنم ، و او عفت ورزید ، و او از راستگویان است . ↑
  • – من خویشتن را تبرئه نمی کنم ، زیرا که نفس اماره و سرکش ، شخص را به کارهای زشت می کشاند ، مگر آن که خداوند از نظر شفقت ، شخص را نگاه دارد ، چون که پروردگار من آمرزنده و مهربان است . ↑
  • – یُصهر : ذوب شدن. ↑
  • – شاه گفت : یوسف را بیاورید تا برای ملازمت خود او را آزاد سازم . چون شاه با یوسف مذاکره و گفتگو نمود . گفت : از امروز ، تو در نزد ما منزلت داری و امین ما هستی . ↑
  • – ما ایوب را بنده صابری یافتیم چه نیکو بنده ای بود که دائم رجوع و توجهش به درگاه ما بود . ↑
  • – و باز ای رسول یاد کن از بندگان ما ابراهیم و اسحق و یعقوب که همه صاحب اقتدار و بصیرت بودند . ↑
  • – مسَّهُ : عارض شد . ↑
  • – الضر : بدبختی . ↑
  • – طودٍ : کوه . ↑
  • – بَرَتک : تو را رنجور کرد . ↑
  • – کرب : مصیبت . ↑
  • – شعیب بازگفت ای قوم آیا طایفه من عزتش نزد شما پیش از خدا است و خدا را به کلی فراموش کردید خدای من به هر چه شما می کنید آگاه است . بازگفت ای قوم شما هر کاری که می توانید انجام دهید من هر چه موظفم خواهم کرد به زودی شما خواهید دانست که عذاب ذلت و خواری بر کدام یک از من و شما می آید و دروغگوی ما کیست پس شما منتظر باشید که من هم منتظر اویم . ↑
جهت
موضوعات: بدون موضوع  لینک ثابت
 [ 02:51:00 ب.ظ ]




۴۱۶/۰وجود دارد۲۳/۰۸۸/۵تأییدآتانا سیوس(۲۰۱۳)، ساهین و زهیرکیتاپسی(۲۰۱۱)،آکر(۱۹۹۱) ، یو و دیگران(۲۰۰۰) ، زینبایر و بکی(۲۰۰۴) ، آتیلگان(۲۰۰۶) ، گیل و همکاران(۲۰۰۷) ، هرندی و رحیم نیا(۱۳۹۱)، گیلانی نیا و موسویان (۱۳۸۹)، شمس و دیگران(۱۳۸۷) ، ضربی و دیگران(۱۳۸۷) ، شفیع و دیگران(۱۳۷۸)

۵-۵٫ پیشنهادات تحقیق
۵-۵-۱٫ پیشنهادات کاربردی

    • با توجه به رابطه مستقیم متغیر خانواده و ارزش ویژه برند و نتیجه این پژوهش و پژوهشهای دیگران پیشنهاد می گردد که مدیران توجه خاصی به عامل خانواده داشته باشند.زیرا بدلیل شناخت اعضاء از یکدیگر و حس اعتمادی که میان افراد خانواده وجود دارد و خو گرفتی با یک محصول از دوران بچگی و ذهنیتی که از محصول که در ذهن افراد باقی می ماند باید یک خاطره خوب از مصرف محصول در خانواده در ذهن باقی بگذارند.مدیران بازاریابی میتوانند در تبلیغات خود نقش مصرف محصول در خانواده ها را پررنگتر کنند.

    • با توجه به رابطه مستقیم تبلیغات دهان به دهان و ارزش ویژه برند، پیشنهاد می گردد که با ایجاد شبکه های اجتماعی کاربر پسند یا ایجاد یک پنل مخصوص برای خود در شبکه های اجتماعی، ارتباطات بازاریابی و تبلیغات را افزایش داد. پیگیری و بررسی انتقادها و اطلاعاتی که در شبکه های اجتماعی بین افراد رد و بدل می شود و پاسخ و واکنش مناسب به آنها و حتی تشکیل یک کمیته بررسی به منظور بررسی ارتباطات دهان به دهان مثبت و منفی و مدیریت آنها در راستای موفقیت شرکت.

عکس مرتبط با شبکه های اجتماعی

    • با توجه به رابطه تداعی برند و ارزش ویژه برند پیشنهاد می گردد که شرکت ها از عناوین و یا مفاهیم مثبت، جذاب و خاصی برای تداعی استفاده نمایند که با دیگر تداعی کنندها تداخل نداشته باشد همچنین به آسانی تداعی شود. مانند علامت ضربدر برای پاک که با دیدن هر علامت ضربدر به صورت ناخودآگاه کلمه پاک یادت نره در ذهن مصرف کننده تداعی میشود. شرکتها میتوانند با برنامههای حمایتی(از تیم های ورزشی ، گروه های فرهنگی ، هنری و…) یا کمک به سازمانهای خیریه ، مشارکت در فعالیتهای اجتماعی و… تداعی را تقویت کنند. به کاربستن بسته بندیها، طرحها و رنگهایی که با توجه به فرهنگ مردم آن منطقه، با پرستیژ، جلوه نماید. همچنین می توان از فروشگاههایی برای عرضه برندها استفاده کرد که تصویر آنها در ذهن مشتریان، نمادی از پرستیژ برندها باشد، زیرا تصویر ذهنی خوب، توجه، تماس ها و بازدیدهای بیشتری از سوی مشتریان بالقوه را به خود جلب کرده و تداعیهای مثبتی را در ذهن مصرف کنندگان، ایجاد مینماید.

 تصویر درباره جامعه شناسی و علوم اجتماعی

  • با توجه به رابطه وفاداری برند بر ارزش ویژه برند پیشنهاد می گردد که شرکتها محصولاتی به بازار عرضه کنند که از هر جهت بتواند مشتریان را راضی نگه داشته و باعث ایجاد وفاداری در آنان شود که دیگر سراغ برندهای دیگر نروند و تا آمدن محصول بعدی منتظر بمانند یا تمایل به پرداخت بیشتر پول داشته و یا تبلیغات دهان به دهان مثبتی در راستای تبلیغ و رشد و گسترش برند داشته باشند. مدیران باید پیوسته نیازها و خواسته های مصرف کننده گان و یا مشتریان را مورد تجزیه و تحلیل قرار داده و محصولات را با توجه به نیاز بازار به روزرسانی کنند و زمینه وفاداری مصرف کنندگان را فراهم سازند.
  • با توجه به رابطه کیفیت بر ارزش ویژه برند پیشنهاد می گردد مدیران و مسئولین مربوطه شرکت ها به مقوله کیفیت درک شده توجه بخصوصی داشته باشند و بتوانند کیفیت درک شده خود را هر روز ارتقاء دهند که در این راستا میتوانند با بهره گرفتن از تکنولوژی های مدرن ، پاسخگویی مناسب به مشتریان در جهت حل مشکل، کیفیت درک شده را بالا ببرند. باید کیفیت به گونه ای باشد که هر وقت مشتری بخواهد محصول مربوطه را خریداری کند همیشه به آن برند اعتماد کند و از منظرش این برند بهترین کیفیت را داشته باشد.

۵-۵-۲٫ پیشنهادات برای تحقیقات آتی

  • پیشنهاد می گردد در تحقیقات آتی از ابزار های دیگر مانند مصاحبه نیز استفاده گردد.
  • پیشنهاد می گردد در تحقیقات آتی به سایر خدمات بانکداری الکترونیکی از جمله موبایل بانک و تلفن بانک پرداخته شود
  • بررسی تاثیر دیگر متغیرهای بازاریابی اعم از تبلیغات ، قیمت ، ترفیعات بر ارزش ویژه نام و نشان تجاری
  • پیشنهاد می گردد در تحقیقات آتی علاوه بر نظرات خانواده درباره برند به نظرات دوستان ، فامیل و … درباره برند نیز پرداخته شود و آنها را با یکدیگر مقایسه نمود

۵-۶٫ محدودیت های تحقیق

  • ناکافی بودن ابزار پرسشنامه
  • نپرداختن به سایر خدمات بانکداری الکترنیکی از جمله موبایل بانک و تلفن بانک
  • بررسی نکردن تمام عواملی که بر ارزش ویژه برند تاثیر می گذارد
  • بررسی نکردن عواملی مانند نظرات دوستان ، فامیل و … درباره برند

منابع:

    1. اخلاصی، امیر،(۱۳۹۲)، اصول برندسازی، با رو یکرد ارتباطات یکپارچه بازاریابی،تهران، انتشارات علمی علوم اجتماعی.
    2. ابراهیمی، عبدالحمید؛ خیری، بهرام ؛ یادگاری نیارکی، سمیه ،(۱۳۸۸)، ارزیابی عوامل موثر بر ارزش ویژه برند مبتنی بر نظر مصرف کننده،مجله مدیریت بازاریابی ، سال چهارم ، شماره ۷، صص۳۴-۴۷٫
    3. الهیاری ، اشکان. ۱۳۸۸ ، بررسی رابطۀ بین تصویر از عناصر معنا بخش برند و شناخت برند، براساس مدل ارزش ویژه برند مبتنی بر مشتری، پایان نامه کارشناسی ارشد، دانشگاه تهران ، دانشکده مدیریت
    4. انصاری،علیرضا،(۱۳۹۱)، عوامل موثر بر وفاداری مشتری،پایان نامه کارشناسی ارشد، دانشگاه آزاد رشت،مدیریت بازرگانی
موضوعات: بدون موضوع  لینک ثابت
 [ 02:51:00 ب.ظ ]




نمودار ۴-۳- مقایسه سطوح دستورزی از نظر تعداد ردیف دانه در بلال

نمودار ۴-۴- مقایسه اثر متقابل سطوح نیتروژن و سطوح دستورزی از نظر تعداد ردیف دانه در بلال
۴-۳- تعداد دانه در بلال
تعداد دانه در بلال بطور معنیداری تحت تأثیر سطوح دستورزی (۰۱/۰≥P) قرار گرفت (جدول ۴-۱) به نحوی که بیشترین تعداد دانه در بلال (۰۰/۵۰۶) از تیمار شاهد بدست آمد و بین تیمارهای شاهد، پاکتگذاری روی بلال و برگزدایی جزئی تفاوت چندانی وجود ندارد و کمترین تعداد دانه در بلال (۱۳/۲۳۱) در تیمار حذف ۵۰ درصد بلال مشاهده شد (جدول ۴-۲، نمودار ۴-۵). تولنآر و دینارد (۱۹۷۸) مشاهده کردند که تیمار برگ زدایی ۲ هفته بعد از پیدایش نیمی از کاکلها، تعداد دانه های بلال را تحت تأثیر قرار میدهد. امام و ثقه لاسلامی (۱۳۷۸) گزارش کردند تعداد دانه در بلال در تیمار حذف انتهایی همه برگها ۱۱ درصد افزایش و در تیمار حذف همه برگها نسبت به شاهد ۸ درصد کاهش نشان داد. کارکوا و همکاران (۲۰۰۳) بیان کردند کاهش در تعداد دانه در بلال در اثر افزایش شدت برگزدایی نتیجه کاهش در فتوسنتز جاری است. از طرف دیگر تعداد دانه در بلال تحت تأثیر سطوح نیتروژن قرار نگرفت (جدول ۱-۴).
برهمکنش سطوح نیتروژن و سطوح دستورزی تأثیر معنیداری بر تعداد دانه در بلال دارد (۰۱/۰≥P) (جدول ۴-۱). بررسیها حاکیست که کاربرد ۱۱۰ کیلوگرم کود اوره در هکتار در تیمار شاهد بیشترین تعداد دانه در بلال (۰۰/۵۲۴) را سبب میشود و کمترین تعداد دانه در بلال (۵۰/۲۳۰) در تیمار عدم کاربرد کود اوره و حذف ۵۰ درصد بلال مشاهده شد. در هر دو تیمار کودی بیشترین تعداد دانه در بلال از تیمار شاهد و کمترین تعداد دانه در بلال از تیمار حذف ۵۰ درصد بلال به دست آمد (جدول ۴-۳، نمودار ۴-۶). همان طور که در نمودار برهمکنش سطوح نیتروژن و سطوح دستورزی مشاهده میشود با کاهش مبدأ (برگزدایی جزئی)، تعداد دانه در بلال نسبت به شاهد تفاوت معنیداری نداشت و تعداد دانه در بلال کاهش پیدا نکرد در صورتیکه محدود کردن مقصد (کاهش مقصد) سبب کاهش تعداد دانه در بلال نسبت به شاهد شد که این بدان علت است که ذرت گیاهی مقصد محدود است.

نمودار ۴-۵- مقایسه سطوح دستورزی از نظر تعداد دانه در بلال

نمودار ۴-۶- مقایسه اثر متقابل سطوح نیتروژن و سطوح دستورزی از نظر تعداد دانه در بلال
۴-۴- وزن هزار دانه
بر اساس نتایج جدول تجزیه واریانس ۴-۱ وزن هزار دانه در میان تیمارهای سطوح نیتروژن تفاوت معنیداری با هم نداشتند.
وزن هزار دانه بطور معنیداری تحت تأثیر سطوح دستورزی (۰۱/۰≥P) قرار گرفت (جدول ۴-۱) به نحوی که بیشترین وزن هزار دانه (۲۴/۲۶۳ گرم) از تیمار حذف ۵۰ درصد بلال و کمترین وزن هزار دانه (۷۹/۹۰ گرم) از تیمار پاکتگذاری روی بلال بدست آمد (جدول ۴-۲، نمودار ۴-۷). امام و تدین (۱۳۷۸) گزارش کردند حداکثر عملکرد دانه در بین تیمارهای برگزدایی از باقی گذاشتن دو برگ بالای بلال بدست آمد. لایر و همکاران (۲۰۰۴) گزارش کردند تشدید برگزدایی در ذرت باعث کاهش عملکرد دانه میشود و در نتیجه کاهش توأم برگ و عملکرد دانه سبب کاهش عملکرد دانه میشود. تولنآر و دینارد (۱۹۷۸) گزارش کردند تیمارهای برگ زدایی دیرتر، بر وزن دانه ها تأثیر گذاشته بود. پس از برگزدایی، مقدار کربوهیدراتهای محلول ساقه به سرعت کاهش پیدا کرد، که نشان دهنده تسریع در مصرف کربوهیدراتهای محلول ساقه برای رشد دانه ها بوده است. امام و ثقهالاسلامی (۱۳۷۸) گزارش کردند بیشترین وزن هزار دانه از تیمار حذف نیمه انتهایی تمامی برگها بدست آمد و کمترین وزن هزار دانه در تیمار حذف تمامی برگها مشاهده شد. آفرینش (۱۳۸۴) گزارش کرد بیشترین وزن هزار دانه از تیمار قطع برگها در ۳۰ روز پس از پایان گردهافشانی بدست آمد. بوراس و همکاران (۲۰۰۴) در بررسی اثر تغییر نسبت مبدأ-مقصد بر وزن خشک دانه در گیاه ذرت مشخص کردند که با کاهش فراهمی مواد پرورده در طول دوره پر شدن دانه، وزن خشک دانه ها کاهش شدیدی پیدا میکند ولی در مقابل، افزایش فراهمی مواد پرورده در ازاء هر دانه، واکنش قابل توجهی را نشان نمیدهد. این نتایج حاکی از آن است که گیاه ذرت در اغلب شرایط زراعی محصولی مقصد محدود میباشد. روی و بیسواس (۱۹۹۲) ابراز عقیده کرند سربرداری از بالای بلال باعث افزایش وزن هزار دانه میشود، درحالی که با افزایش تراکم گیاهی وزن هزار دانه کاهش مییابد.
برهمکنش سطوح نیتروژن و سطوح دستورزی در سطح ۵ درصد بر وزن هزار دانه تأثیر معنیداری داشت (جدول ۴-۱)، آنچنان که وزن هزار دانه در تیمار کاربرد ۱۱۰ کیلوگرم کود اوره در هکتار و حذف ۵۰ درصد بلال بیشترین مقدار (۹۶/۲۷۰ گرم) بود و کمترین وزن هزار دانه (۰۱/۸۴ گرم) در تیمار عدم کاربرد کود اوره و پاکتگذاری روی بلال مشاهده شد. در هر دو تیمار کودی بیشترین وزن هزار دانه در تیمار حذف ۵۰ درصد بلال مشاهده گردید که نشان دهنده این است که به دلیل کاهش مقصد، تسهیم مواد پرورده در دانه های باقیمانده افزایش مییابد که به علت مقصد محدود بودن ذرت است و کمترین وزن هزار دانه در تیمار پاکتگذاری روی بلال مشاهده شد (جدول ۴-۳، نمودار ۴-۸).

نمودار ۴-۷- مقایسه سطوح دستورزی از نظر وزن هزار دانه

نمودار ۴-۸- مقایسه اثر متقابل سطوح نیتروژن و سطوح دستورزی از نظر وزن هزار دانه
۴-۵- عملکرد دانه
عملکرد دانه بطور معنیداری تحت تأثیر سطوح نیتروژن قرا
ر نگرفت اما تحت تأثیر سطوح دستورزی قرار گرفت (جدول ۴-۱). آنچنان که بیشترین عملکرد دانه (۰/۸۳۶۸ کیلوگرم در هکتار) در تیمار شاهد مشاهده شد و بین تیمارهای شاهد و برگزدایی جزئی تفاوت معنیداری دیده نمیشود. کمترین عملکرد دانه به میزان ۵/۲۹۷۲ کیلوگرم در هکتار از تیمار پاکتگذاری روی بلال به دست آمد (جدول ۴-۲، نمودار ۴-۹). امام و ثقه الاسلامی (۱۳۷۸) گزارش کردند حذف تمام برگهای گیاه ذرت ۲۰ روز پس از ظهور کامل کاکل، باعث کاهش عملکرد به میزان ۵۲ درصد گردید. جونز و سیمونز (۱۹۸۳) و کارکوا و همکاران (۲۰۰۳) علت کاهش عملکرد دانه ذرت در اثر حذف برگها را کاهش در فتوسنتز جاری بیان کردند.
برهمکنش سطوح نیتروژن و سطوح دستورزی بر عملکرد دانه در سطح ۵ درصد تأثیر معنیداری داشت (جدول ۴-۱). عملکرد دانه در تیمار کاربرد ۱۱۰ کیلوگرم کود اوره در هکتار و برگزدایی جزئی بیشترین مقدار (۶۸۸۳ کیلوگرم در هکتار) بود و کمترین عملکرد دانه (۲۶۲۲ کیلوگرم در هکتار) در تیمار عدم کاربرد کود اوره و پاکتگذاری روی بلال مشاهده شد. در هر دو تیمار کودی، کم کردن مبدأ سبب تغییر در عملکرد دانه نشده است که حاکی از مقصد محدود بودن ذرت است (جدول ۴-۳، نمودار ۴-۱۰).

نمودار ۴-۹- مقایسه سطوح دستورزی از نظر عملکرد دانه

نمودار ۴-۱۰- مقایسه اثر متقابل سطوح نیتروژن و سطوح دستورزی از نظر عملکرد دانه
۴-۶- طول بلال
تأثیر سطوح مختلف دستورزی بر طول بلال معنیدار (۰۵/۰≥P) گردید (جدول ۴-۴) به نحوی که بیشترین طول بلال (۷۰/۳۳ سانتیمتر) از تیمار پاکتگذاری روی بلال بدست آمد و بین تیمارهای شاهد، پاکتگذاری روی بلال و برگزدایی جزئی از نظر طول بلال تفاوت معنیداری دیده نمیشود و کمترین طول بلال (۰۰/۱۹ سانتیمتر) در تیمار حذف ۵۰ درصد بلال مشاهده گردید (جدول ۴-۵، نمودار ۴-۱۱). کارکوا و همکاران (۲۰۰۳) گزارش کردند با افزایش شدت برگزدایی طول بلال کاهش مییابد. از طرف دیگر طول بلال در میان تیمارهای سطوح نیتروژن تفاوت معنیداری با هم نداشت (جدول ۴-۴).
بر اساس جدول تجزیه واریانس ۴-۴ برهمکنش سطوح نیتروژن و سطوح دستورزی در سطح احتمال ۵ درصد تأثیر معنیداری بر طول بلال داشت. بیشترین طول بلال (۳۸/۳۴ سانتیمتر) در تیمار عدم کاربرد کود اوره و پاکتگذاری روی بلال و کمترین طول بلال (۹۶/۱۹ سانتیمتر) در تیمار عدم کاربرد کود اوره و حذف ۵۰ درصد بلال مشاهده گردید. در هر دو سطح کودی پاکتگذاری روی بلال بیشترین و حذف ۵۰ درصد بلال کمترین طول بلال را داشت (جدول ۴-۶، نمودار ۴-۱۲).
جدول ۴-۴- نتایج تجزیه واریانس برخی خصوصیات زراعی ذرت

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:51:00 ب.ظ ]




– در استعمال عرفی عبارت از این است که کسی، ساخت شی ای را از صنعت گر یا هنرمندی تقاضا کند.
دانلود پایان نامه

 

بند دوم: تعریف اصطلاحی (فقهی- حقوقی)

 

از آن جا که استصناع به عنوان رابطه ای قراردادی از گذشته مطرح بوده است، فقها و حقوق دانان به آن توجهی خاص داشته و هر کدام به بیان تعریفی در رابطه با ماهیت استصناع از دیدگاه فقهی و حقوقی پرداخته اند که در ادامه به ذکر مواردی از این تعاریف می پردازیم.
-در دایره المعارف قاموس عام لکل فن ئ مطلب درباره کلمه استصناع چنین آمده است: الاستصناع فی الشرع بیع ما یصنعه الصانع عیناً، فیطلب من الصانع العمل و العین جمیعاً، فلو کان العین من المستصنع کان الاجاره لا استصناعاً[۷]
-الاستصناع عقد مقاوله مع صاحب الصنعه علی ان یعمل شیئاً فالعامل صانع و المشتری مستصنع و الشی مصنوع و شرط ان تکون العین و العمل من الصانع، فان کان العین من المستصنع کان العقد اجاره
– الاستصناع هو عقد مع صناع علی عمل شی معین فی الذمه ای العقد علی شراء ما سیصنعه الصانع و تکون العین و العمل من الصانع، فاذا کانت العین من المستصنع لا من الصانع فان العقد یکون اجاره لا استصناعاً [۸]
-در اصطلاح فقهی و حقوقی، استصناع قراردادی است که به موجب آن یکی از طرفین قرارداد، در مقابل مبلغی معین، ساخت و تحویل کالا یا طرح مشخصی را در زمان معین نسبت به طرف دیگر به عهده می گیرد.[۹]
-در کتاب قوانین فقه اسلامی درباره عقد استصناع چنین گفته شده است: « استصناع مقاوله ای است که واقع می شود با اهل صنعت که چیزی درست کنند. در این عقد عامل صانع و مشتری را مستصنع و موضوع را مصنوع می نامند. بنابراین عقد، شیی مصنوع نتیجه عمل و عینی است که صانع تسلیم می کند و به طوری که ملاحظه می شود، مصنوع در هنگام انعقاد عقد موجود نیست و در آینده درست شده تحویل می شود. مع ذلک این عقد را فقها استحساناً و استناداً به سنت و اجماع تجویز نموده اند.[۱۰]
– در ترمینولوژی حقوق نیز در ذیل کلمه استصناع چنین آمده است: سفارش های صنعتی از مشتریان به سازندگان مانند سفارش ساختن یک دست مبل یا یک اتومبیل فیات مخصوص یا روکش چوبی رادیاتورهای شوفاژ منازل. سفارش پذیر، مصالح را از خود می گذارد. این عقد مرکب از بیع (در رابطه با مواد اولیه) و اجاره عمل است.[۱۱]
-مراد از عقد استصناع یا قرارداد سفارش این است که کسی به نزد صنعت گر بیاید و از او بخواهد که تعدادی از کالایی را که می سازد به ملکیت او درآورد. در این حال قراردادی میان این دو به امضاء می رسد که صاحب صنعت تعداد مورد توافق نامه هم مواد کالا و هم عملیات ساخت، بر عهده سازنده می باشد.[۱۲]
با توجه به تعاریف ارائه شده توسط فقها و حقوقدانان و عرف حاکم بر این قرارداد، عقد استصناع را می توان چنین تعریف کرد:
« استصناع عقدی است که به موجب آن یکی از طرفین متعهد به پرداخت عوض در ازای مالی می شود که به سفارش او، توسط طرف دیگر قرارداد ساخته خواهد شد و در زمان مقرر تحویل او می گردد.»
با توجه به تعریفی که از عقد استصناع ارائه کردیم، در ادامه برای روشن تر شدن موضوع به بیان ارکان و ویژگی های عقد استصناع خواهیم پرداخت.

 

 

 

گفتار دوم: ارکان عقد استصناع

 

ارکان عقد استصناع عبارتنداز : [۱۳]

 

بند اول: طرفین قرارداد

 

در قرارداد استصناع، سفارش دهنده را مستصنع و سازنده (صاحب صنعت) را صانع می گویند، مستصنع و صانع باید شرایط عمومی طرفین قراردادها مانند بلوغ، عقل، رشد، قصد و اختیار را دارا باشند، همان طور که خواهد آمد در ماهیت فقهی قرارداد استصناع اختلاف نظر هست، برخی از فقها آن را در قالب یکی از قراردادهای خاص می دانند و برخی آن را قرارداد مستقلی می پندارند، اگر قرارداد استصناع را یکی از قراردادهای خاص بدانیم، افزون بر شرایط عمومی قراردادها، طرفین باید شرایط قرارداد خاص را نیز دارا باشند. برای مثال، کسانی که قرارداد استصناع را نوعی بیع می دانند. در این صورت طرفین معامله بر اساس ماده ۳۴۵ ق.م باید علاوه بر اهلیت قانونی برای معامله، اهلیت برای تصرف در مبیع یا ثمن را نیز داشته باشند.

 

بند دوم: عقد (ایجاب و قبول )

 

قرارداد استصناع به عنوان عقدی صحیح همانند سایر قراردادها، نیاز به ابراز اراده و رضایت طرفین به انعقاد قرارداد دارد و البته این ابزار اراده می تواند به صورت گفتاری، نوشتاری و یا عملی ( با دادن پیش پرداخت)، منعقد گردد و هر لفظ و عملی که مقصود طرفین را برساند، کفایت می کند.

 

بند سوم: موضوع استصناع

 

به کالا یا پروژه ای که سفارش ساخت آن داده می شود، موضوع قرارداد استصناع یا مستصنع می گویند، مصنوع باید افزون بر جواز ساخت از جهت شرعی و قانونی، قابلیت ساخت و تحویل در مقرر را داشته باشد.
هر نوع کالایی که نیاز به ساخت شدن و پدید آمدن به وسیله صنعت گر یا هنرمند یا سازنده داشته باشد مانند کشتی، هواپیما، درو پنجره، کفش و غیره می تواند موضوع عقد استصناع واقع شود. خصوصیات و صفات مورد استصناع باید هنگام سفارش به صورت کامل معین شود.
مورد استصناع باید هنگام عقد موجود نباشد. بنابراین اگر صنعت گر فردی از مورد معامله را قبلاً ساخته و آماده داشته باشد، معامله مذکور بیع معمولی است. همچنین، مواد اولیه مورد استصناع باید توسط صانع تهیه شود و در صورتی که مواد اولیه توسط مستصنع تهیه گردد، معامله مذکور اجاره اشخاص می باشد و صانع فقط نقش اجیر را خواهد داشت.

 

بند چهارم: عوض

 

مبلغی که در قبال ساخت و تحویل کالا یا پروژه پرداخت می شود را عوض استصناع می گویند، عوض در قرارداد استصناع همانند سایر قراردادها به طور معمول پول رایج است، اگر چه می تواند کالا و خدمت نیز باشد. اگر قرارداد استصناع را یکی از انواع قراردادهای خاص شناخته شده بدانیم، عوضین علاوه بر شرایط عمومی، باید شرایط عوضین آن قرارداد خاص را نیز داشته باشند. برای مثال اگر استصناع را از مصادیق بیع سلف بدانیم به اعتقاد مشهور فقها بایستی کل عوض در مجلس عقد پرداخت شود. اما اگر استصناع را قرارداد مستقلی بدانیم، عوض استصناع می تواند به صورت نقد، نسیه یا ترکیبی از نقد و نسیه باشد، به این معنی که بخشی از آن به صورت پیش پرداخت و بخش دیگر، طبق زمان بندی معین یا بر اساس پیشرفت تولید کالا، پرداخت شود.

 

گفتار سوم: ویژگی های عقد استصناع

 

چند نکته در قرارداد استصناع وجود دارد که آن را از سایر قراردادها متمایز می کند. این ویژگی ها عبارتند از این که:

 

 

    1. در قرارداد استصناع به طور معمول کالای مورد نظر (موضوع استصناع) موجود نیست و سازنده در آینده آن را ساخته و تحویل می دهد. (البته در برخی از انواع استصناع آن چنان که اشاره خواهد شد ساخت کالا تا مراحلی پیش رفته ولی تکمیل نشده است.)

 

    1. در قرارداد استصناع تهیه ی مواد اولیه و لوازم کار به عهده ی سازنده است، چرا که اگر مواد و لوازم توسط طرف دیگر معامله فراهم شود، قرارداد اجاره اشخاص خواهد بود نه استصناع.

 

    1. به طور معمول در زمان انعقاد قرارداد، کل ثمن پرداخت نمی شود؛ بلکه بخشی از آن به عنوان پیش پرداخت داده می شود و بخش دیگر به صورت دفعی یا تدریجی تا زمان تحویل کالا پرداخت می گردد.گاهی بخشی از آن به بعد از تحویل هم منتقل می شود.[۱۴]در عقد استصناع بر خلاف بیع، علاوه بر کالای ساخته شده، عمل صانع هم مورد معامله می باشد.

 

    1. در عقد استصناع لازم است کالائی که مورد تعهد قرار می گیرد، معلوم باشد. یعنی باید جنس و نوع و مقدار آن تعیین شود.( بر خلاف عقد بیع عین معین که تعیین جنس و نوع و مقدار لازم نیست)

 

    1. مدت زمانی که صانع باید در آن مدت، کالای مورد نظر را ساخته و تحویل مستصنع دهد و همچنین مواعد زمانی که عوض باید به صانع داده شود، لزوماً باید معلوم باشد. در غیر این صورت، به سبب وجود غرر، استصناع باطل خواهد بود.

 

  1. استصناع بر اساس عموم «اوفوا بالعقود» و همچنین قاعده «اصاله اللزوم» عقدی است لازم و طرفین قرارداد نمی توانند بدون وجود اسباب زوال قرارداد از آن سرباز زنند. لذا چنان چه صانع یا مستصنع از ایفای تعهدات خود خوداری کنند، الزام به اجرای آن می گردند و در صورت عدم امکان الزام به اجرا، قرارداد فسخ می شود.

 

گفتار چهارم: انواع استصناع

 

سفارش ساخت کالا و احداث پروژه به چند صورت قابل تصور است، که از جهت تحلیل فقهی و حقوقی متفاوت هستند و عرف در رابطه با آن دیدگاه های متفاوت دارد.[۱۵]

 

بند اول : سفارش ساخت و تکمیل کالا یا طرح نیمه تمام

 

گاهی تولید کننده ای بدون سفارش، شروع به تولید کالایی چون قالی،ساختمان، کشتی و هواپیما کرده و مراحلی از تولید را پشت سر می گذارد،آن گاه مشتری آن را می بیند و تقاضا می کند تا تولید کننده آن را تکمیل کرده،تحویل او دهد. تولید کننده تقاضا را پذیرفته و طبق قرارداد متعهد می گردد در مقابل میلغ معینی (که به توافق می رسند) کالا را ساخته در زمان معینی تحویل مشتری دهد و مشتری نیز متعهد می شود بهای کالا را طبق قرارداد بپردازد.

 

بند دوم: سفارش ساخت تعدادی از کالای تولیدی یک تولید کننده

 

گاهی شخص حقیقی یا حقوقی به تولید کننده ای، سفارش تولید و تحویل تعداد معینی از کالای تولیدی آن تولید کننده را می دهد، برای مثال مدرسه ای یا دانشگاهی به کارخانه ای تولید کننده ی محصولات چوبی،سفارش ساخت هزار عدد میز و صندلی می دهد، یا شرکت حمل و نقلی سفارش ساخت پنجاه دستگاه کامیون به کارخانه ی خودروسازی می دهد و سازنده طبق قرارداد متعهد می شود در مقابل مبلغ معین در زمان مشخص کالاهای مورد نظر را ساخته و تحویل دهد.

 

بند سوم:سفارش ساخت کالا با ویژگی های خاص

 

گاهی سفارش دهنده، سفارش ساخت تعدادی کالا با ویژگی های خاص را به سازنده می دهد،برای مثال شرکت کشتی رانی یا هواپیمایی،سفارش ساخت کشتی یا هواپیمایی با ظرفیت، قدرت، دکوراسیون، رنگ و نقش خاصی را به کارخانه کشتی سازی یا هواپیما سازی می دهد و سازنده طبق قرارداد متعهد می شود در مقابل مبلغ معین در زمان مشخص کالای مورد نظر را ساخته و تحویل دهد.

 

بند چهارم:سفارش احداث طرح و پروژه ای با ویژگی های خاص

 

گاهی سفارش دهنده،سفارش احداث و تحویل طرح و پروژه ی خاصی با مشخصات معین را به سازنده می دهد، برای مثال دولت سفارش ساخت دانشگاه، دبیرستان یا بیمارستانی را در مکان معین با مساحت و ظرفیت و مصالح مشخص به پیمانکاری می دهد یا ساخت جاده، اتوبان یا فرودگاهی را به شرکت راه و ساختمانی سفارش می دهد و سازنده طبق قرارداد متعهد می شود طی زمان بندی معین در مقابل مبلغ معین، طرح مورد نظر را ساخته و تحویل دهد.
در این نوع طرح بر خلاف نوع قبل در زمان انعقاد قرارداد قسمتی از مورد معامله(زمین محل احداث پروژه) موجود است.

 

بند پنجم: سفارش ساخت برای انجام معامله

 

گاهی سفارش دهنده قراردادی با سازنده منعقد نمی کند،ولی در عین حال سفارش ساخت تعدادی کالا را می دهد و با سازنده قرار می گذارد که در صورت ساخت بر اساس قیمت معین از او خریداری کند.

 

گفتار پنجم:دیدگاه های فقهی و حقوقی درباره عقد استصناع

 

عقد استصناع، قراردادی نیست که به تازگی شکل گرفته باشد، بلکه از زمان های گذشته بین مردم مرسوم بوده و افراد در روابط اقتصادی خود از آن استفاده می کردند و بر اساس آن، از کسی که مهارت خاصی در زمینه ای داشته، می خواستند که برای آنها کالایی متناسب با ویژگی هایی کهتعیین می کنند، بسازد پس از اسلا م نیز این قرارداد بین مسلمانان مرسوم بوده و مطابق برخی نقل ها، پیامبر اکرم (ص) سفارش ساخت منبر به نجار[۱۶] و انگشتر به زرگر [۱۷]را داده بودند.
عکس مرتبط با اقتصاد
همانطور که می دانیم در گذشته این قرار داد معمولاً برای روابط ساده اقتصادی نظیر ساخت کفش، ظرف، شمشیر و غیره مورد استفاده قرار می گرفت و لیکن به مرور زمان، موضوع قرارداد استصناع به تناسب پیشرفت صنعت و تکنولوژی توسعه یافته است و امروزه شامل انواع سفارش ساخت کشتی، هواپیما، قطار، فرودگاه، سد، بزرگراه، بیمارستان، دانشگاه و کالاها و طرحهای مشابه می شود.
از آنجا که این عقد در روابط میان مسلمانان معمول بوده، فقها و حقوق دانان مسلمان در عصرهای مختلف به بررسی ماهیت و احکام آن پرداخته اند که ما در بحث دیدگاه های فقهی و حقوقی استصناع ابتدائاً به ذکر آراء اندیشمندان مذاهب چهارگانه اهل سنت درباره عقد استصناع پرداخته و پس از آن، نظرات فقهای امامیه و حقوق دانان در این رابطه را بررسی خواهیم کرد.

 

بند اول: فقها و حقوق دانان عامه

 

در میان مذاهب چهارگانه اهل سنت تنها حنفی ها به صورت مبسوط به بحث از عقد استصناع پرداخته اند، ولیکن با بررسی کلام بزرگان سایر مذاهب می توان دیدگاه آنها درباره ماهیت استصناع را نیز تشخیص داد.
با توجه به مطلب فوق، در این قسمت ابتدا دیدگاه اصلی مذاهب مالکی و شافعی وحنبلی درباره استصناع را به صورت مختصر بیان نموده و سپس درباره دیدگاه فقهای حنفی به صورت مبسوط بحث می کنیم و پس از آن با توجه به اینکه حقوق دانان حنفی نیز در این زمینه به بیان نظرات خود پرداخته اند، به نحو مشروح درباره آن صحبت خواهیم کرد.
الف: استصناع در فقه مالکی
مالکی ها، استصناع را نوعی عقد سلف می دانند و احکام آن را در استصناع جاری می کنند.بنابراین، استصناع را در صورتی صحیح می دانند که کل مبلغی که باید سفارش دهنده(مستصنع) به عنوان عوض به صانع بپردازد، در اول عقد به او تأدیه گردد و موجل بودن آن را باعث بطلان استصناع می دانند.[۱۸]
لازم به ذکر است که مالکی ها تاخیر پرداخت ثمن را تا سه روز جایز و آن را در حکم نقد می دانند.
ب: استصناع در فقه شافعی
شافعی در کتاب الام در ضمن فروعات سلف می نویسد:
«اگر سفارش دهنده شرط کند که (صنعت گر) برایش تشتی از مس و آهن و یا از جنس مس و سرب (یعنی تشتی که از دو جنس تشکیل شده باشد) بسازد،جایز نیست زیرا این دو خالص نیستند تا مقدار هر یک از آن دو شناخته شود.این شرط همانند رنگ در لباس نیست،زیرا رنگ لباس زیوری است که موجب دگرگونی ویژگی لباس نمی شود.اما این اقدام (ساختن کالا از دو عنصر) نوعی افزایش در مورد کالای ساخته شده است و چنین است، هرچیزی که سفارش ساخت آن داده شود.»
از این بیان شافعی چنین بر می آید که اگر مشکل، دو جنس بودن کالای سفارشی فوق باشد،نفس سفارش ساخت اشکال ندارد.
سایر علمای شافعی هم استصناع را جزء فروعات عقد بیع سلم دانسته و آن را عقد مستقل نمی دانند.
دلیل شافعیه بر صحت عقد استصناع آن است که آنها این عقد را ملحق به بیع سلم می کنند و می گویند سلم عنوانی عام است که شامل مصنوعات و غیره می شود و استصناع خاص در مصنوعات است.[۱۹]
ج: استصناع در فقه حنبلی
حنابله استصناع را همان بیع سلم می دانند.و از فقهای حنابله، ابن قدامه در کتاب المغنی، صحت استصناع را مشروط به دانستن شرایط سلم دانسته است.[۲۰]
د: استصناع در فقه حنفی
در میان حنفی ها، فقهای متعددی به بحث از استصناع پرداخته و در باره ماهیت و ویژگی آن و هم چنین آثاری که بر این عقد مترتب می شود،سخن به میان آورده اند.اما به سبب پراکندگی مباحث مربوط به استصناع در فقه حنفی، مسائل موجود در این زمینه را به ترتیب بیان کرده و دیدگاه فقهای مختلف حنفی در آن زمینه را به صورت دسته بندی شده با ذکر عبارات آنها ارائه خواهیم کرد.
۱٫ جواز استصناع
فقهای حنفی، متفق القول استصناع را صحیح دانسته و برای صحت آن، ادله ای ارائه می کنند.
دلائل فقهای حنیفه برای صحت استصناع عبارت است از:
۱-۱-سنت
در این مورد، دو روایت پیرامون سفارش ساخت منبر و انگشتر توسط پیامبر را ذکر کرده و به آن ها استدلال می نمایند.[۲۱]
۲-۱-.اجماع عملی
استصناع از زمان قدیم در معاملات مردم عرفیت فراوانی داشته و در آیات و روایات نیز از آن نهی نشده و غالب خصوصیات عقد بیع سلف را داراست. بنابراین، می توان استصناع را به عنوان عقدی صحیح پنداشت.[۲۲]
عمده دلیل حنیفه بر صحت عقد استصناع، استحسان است؛ که بنابر آن، حکم کلی را به دلیل ضرورت، استثناء کرده اند. در توضیح باید چنین گفت که طبق قاعده کلی بر اساس حدیث نبوی«لاتبع ما لیس عندک»، بیع معدم باطل است و در نتیجه باید گفت، استصناع باطل خواهد بود. اما می توان صحت آن را از طریق استحسان اثبات نمود. به این معنی که از طرفی عموم مردم از قدیم الایام، از استصناع به عنوان صورتی از معاملات روزمره استفاده می کردند و امروزه نیز همین گونه است و ضرورت زندگی اجتماعی انسان ها این اقتضا را دارد که جهت تهیه نیازهای خود به صنعت گر مراجعه کنند. از طرف دیگر، پیامبر فرمود:«لاتجتمع امتی علی الضلاله» و نیز فرمود « ما راه المسلمون حسناً قهو عنداللله حسن و ما راه المسلمون قبیحاً فهو عند الله قبیح».[۲۳]بنابراین اجماع و ضرورت و سنت موجب می شود که استحسان بر قاعده مذکور غلبه کند و استصناع را صحیح بدانیم.
 تصویر درباره جامعه شناسی و علوم اجتماعی

موضوعات: بدون موضوع  لینک ثابت
 [ 02:50:00 ب.ظ ]




بنابراین یکی از ویژگی های اساسی آثار سعدی چه منثور و چه منظوم که موجب آراستگی و زیبایی بیشتر آنها شده موسیقی خوبی است که جناب سعدی به آن ها افزوده. افزایش نغمه و آهنگ سخن غیر مهارت در برگزیدن واژه های ویژه و نحوه نشاندن انها در کنار همدیگر، نیازمند بهره گیری از آرایه های خاصی است و سعدی در هر دو میدان مهارت و استادی به خرج داده است که سعدی علاقه ی زیادی به صنعت آرایی نشان نمی دهد و همانند سایر زمینه های دیگر حد وسط و اعتدال را بر می گزیند.

اهداف تحقیق: همانگونه که در کتابهای معانی به تفصیل بحث شده اگر همه واژگان سازنده ی سخن فصیح و روان باشند و پیوند بین اجزای کلام نیز به خوبی رعایت شده باشد هنوز سخن به مقصد نهایی خود که «بلاغت و رسایی» باشد وارد نمی شود مگر اینکه مقتضای خطاب هم به نیکی رعایت گردد اگر سخن همه ی این ویژگی ها را دارا شد آن وقت است که می توان جان و دل مخاطب را تسخیر کند. سعدی از شاعران و نویسندگانی است که همه ریزه کاری های بلاغی به دقت در آفرینش آثارش رعایت کرده است. وی علاوه بر اینکه در به گزینی واژگان و نحوه ی پیوند بین آنها، نکته ای را فروگذار نکرده در شناخت مقام های سخن هم استادی خاصی بخرج داده است. نحوه ی ادای مطلب (چگونه گفتن) که در واقع خود نوعی رعایت مقتضای حال می باشد در زیبایی آثار وی نقش بسزایی دارد. وی در ضمن آثارش بارها به وجوب رعایت چنین اقتضاهایی اشاره کرده است. وقتی در یک نگاه کلی با خود می اندیشم که مخاطبان سعدی چه کسانی هستند؟ آیا هنر سعدی، هنر خواص است یا خیر؟ می بینیم بخش زیادی از آثار سعدی، جنبه ی همگانی و مردمی دارد. او در خلق آثارش، ظرافتی اعجازگونه بکار برده که ضمن اینکه عوام از آن نصیب می برند خواص نیز از لذت آن محروم نمی مانند و در مجموع می توان گفت که آثار سعدی متعلق به همگان است. حال در چنین فضایی، چگونه می توان مقتضای حال را رعایت کرد به گونه ای که هر دو گروه مخاطبان از آن بهره ببرند و سخن هم از جایگاه والای خود نزول نکند و ملال آور هم نشود. این موضوع البته یکی از رازهای سهل و ممتنع بودن و جذاب بودن سخن سعدی است که دیگران بندرت از عهده ی آن برآمده اند. او می داند که بیشتر مخاطبان، فرصت و حوصله کافی برای خواندن داستانهای طولانی یا قصیده های بلند را ندارند از عهده ی این مشکل برمی آید و با بینش دقیق دو اثر جاویدان خود یعنی گلستان و بوستان را در قالب حکایت ارائه می دهد حکایت هایی که چون بخشی از زندگی را باز می نمایانند می توانند برای هر مخاطبی جذابیت داشته باشند. حجم زیادی از آثار سعدی به ویژه در گلستان را کلمه های قصار و مثل گونه ها پر کرده اند و این نشان دهنده توجه بیش از اندازه سعدی به ایجاز است غرض از این طرح اینست که بگوییم شناخت دقیق سعدی از مقام های سخن در زیبایی آثار وی موثر واقع شده است و اگر از این حیث به آثار سعدی نگریسته شود.
نکات فراوان دیگری به دست خواهد آمد. فضل الله رضا می گوید : «… در شش هفت قرن گذشته کمتر کسی توانسته کتابی دبستانی آراسته تر از گلستان و بوستان سعدی اماده کند. در زمان ما این همه ترجمه ها از کوی و برزن اروپا و آمریکا به ارمغان می آورند هیچ یک شاید هنوز برتر از این کتاب دبستانی هفت قرن پیش آن شیرازی نباشد … » رضا، نگین. شماره ۱۳۲، ص ۱۲
فرضیات تحقیق

 

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:50:00 ب.ظ ]




این آنالیز براساس alignment و مقایسه توالی های حاصل از sequencing در افراد بیمار با توالی های افراد طبیعی صورت می گیرد. این کار توسط نرم افزارهای مختلفی صورت می گیرد. نرم افزارهای مورد استفاده در این آنالیز Gene Runner وCodon code بودند.

Codon code برنامه ای است که نتایج sequencing را با الگو مرجع[۶۶] مقایسه و بررسی می کند. از طریق برنامه gene runner تاثیرات تغییرات نوکلوتیدی را روی توالی اسید آمینه می توان بررسی کرد.
فصل چهارم
تجزیه و تحلیل و بیان نتایج حاصل از تحقیق
در این تحقیق ۱۰۰ خانواده از نقاط مختلف جمع آوری شدند. کل خانواده هایی که در این طرح مورد بررسی قرار گرفته اند، دارای ناشنوایی غیرسندرمی با توارث اتوزومی مغلوب بودند.
۴-۱ نتایج حاصل از مطالعات آنالیز پیوستگی
۴-۱-۱ مارکرهای دارای فرکانس آللی بالا تر
فرکانس آللی مارکرهای ژنتیکی در هر جمعیت با جمعیت دیگر متفاوت است. از آن جایی که تنوع آللی این مارکرها در جمعیت ایران بررسی نشده است، در ابتدا می بایست این تنوع به طور تقریبی در ایران مشخص شود. به همین منظور ۱۰ فرد غیر خویشاوند سالم انتخاب شد. سپس هر کدام از این مارکرهای STR انتخاب شده، به کمک روش [۶۷]PAGE مورد بررسی قرار گرفتند و مارکرهایی که دارای هتروزیگوسیتی بالاتردر جمعیت ایران بودند، اولویت داشتند.
بر این اساس برای هر جایگاه بهترین مارکرها انتخاب و در انجام آنالیز پیوستگی مورد استفاده قرار گرفتند.
در اینجا یک نمونه از عکس ژل پلی آکریل آمید که برای مطالعه فرکانس آللی گذاشته شده است را مورد بررسی قرار می دهیم.
شکل زیر مربوط به مارکر D1S1570 در جایگاه GJB4 می باشد. همانطور که در عکس ژل پلی اکریل آمید مشخص است، این مارکر دارای هتروزیگوسیتی مناسبی است و در ۱۰ نمونه انتخابی می توان آلل های مختلفی را برای این مارکر مشاهده کرد. بنابراین در مطالعات بر روی خانواده ها، این مارکر برای آنالیز پیوستگی در اولویت قرار گرفت.
شکل شکل ۴-۱ ژل پلی آکریل آمید مربوط به تعیین هتروزیگوسیتی مارکرD1S1570
به این ترتیب مارکرهای انتخاب شده در هر جایگاه اولویت بندی شده و مورد استفاده قرار گرفتند که به شرح زیر است:
ژن GJB4
۱)D1S1570 2)D1S496 3)D1S195
ژن GJC3
۱)D7S2498 2) D7S2480 3) D7S477 4) D7S2432
ژن SLITRK6
۱)D13S251 2)D13S253 3)D13S282
ژن SERPINB6
۱)D6S1617 2)D6S1713 3) D6S344
ژن CABP2
۱)D11S1889 2)D11S4155 3)D11S1296
ژن OTOGL
۱)D12S1297 2)D12S64 3)D12S824
ژن NESP4
۱)D19S876 2)D19S909 3)ATA57C01
۴-۱-۲ نتایج آنالیز پیوستگی در خانواده های ناشنوا با توارث مغلوب
نتایج آنالیز پیوستگی و تعیین توالی برای ۱۰۰ خانواده مبتلا به قرار زیر است:
دو خانواده به ژن GJB4(خانواده هایL-304 و L-3082) پیوستگی نشان دادند ولی در تعیین توالی مستقیم آنها جهشی مشاهده نشد.
شش خانواده به ژن GJC3 (خانواده ها L-369 ،L-342 ،L-1902،L-8700225 ، L-1649 و L-353) پیوستگی نشان دادند ولی در تعیین توالی مستقیم آنها جهشی مشاهده نشد.
یک خانواده به ژن SLITRK6 (خانواده هایL-346) پیوستگی نشان داد ولی در تعیین توالی مستقیم آنها جهشی مشاهده نشد.
هشت خانواده به ژن NESP4 (خانواده L-362، L-1108،L-1985t ، L-346، L-1115، L-1731، L-1363، L-3163و L-1385) پیوستگی نشان دادو تعیین توالی مستقیم آن در دست اقدام است.
یک خانواده به ژن SERPINB6 (خانواده L-1731,) پیوستگی نشان داد و تعیین توالی مستقیم آنها در دست اقدام است.
دو خانواده به ژن CABP2 (خانواده های L-822وL-3163 ) پیوستگی نشان دادند و تعیین توالی مستقیم آنها در دست اقدام است.
شش خانواده به ژن OTOGL (خانواده های L-342، L-8700187، L-1346، L-3137، L-3138 وL-348 ) پیوستگی نشان دادند و تعیین توالی مستقیم آنها در دست اقدام است.
۴-۱-۳ خانواده L-3082 و ژن GJB4
ژل های پلی آکریل آمید خانواده L-3082 که به ژن GJB4 پیوستگی نشان داد. از میان مارکرهای مورد استفاده دو مارکر به جایگاه مورد نظر پیوستگی نشان دادند.
شکل ۴-۲ شجره خانواده L-3082
شکل ۴-۳ مارکرD1S1570 که به این ژن پیوستگی نشان داد. F:پدرM :مادر P: پروباند A: فرزند بیمار N : فرزند سالم
شکل ۴-۴ مارکرD1S496 که به این ژن پیوستگی نشان داد. F:پدرM :مادر P: پروباند A: فرزند بیمار N : فرزند سالم
شکل ۴-۵ مارکرD1S195 که به این ژن پیوستگی حاوی اطلاعات مفید نشان نداد.

موضوعات: بدون موضوع  لینک ثابت
 [ 02:50:00 ب.ظ ]




بند اوّل: داشتن سیر منطقی………………………………………………………………………………………..۱۲۳
بند دوم: ارتباط محتوای یک پایه با کتاب سایر پایه ها……………………………………………………۱۲۵
بند سوم: وسعت بخشی تدریجی………………………………………………………………………………..۱۲۶
گفتار سوم: اصول انتخاب زبان و نحوه بیان………………………………………………………………….۱۲۷
بند اوّل: استفاده از واژگان و جملات متناسب با سن مخاطب…………………………………………..۱۲۷
بند دوم: رعایت اصل سادگی و روانی…………………………………………………………………………۱۲۷
بند سوم: استفاده از زبان خاص هر موضوع…………………………………………………………………..۱۲۸
گفتار چهارم: اصول انتخاب تصاویر……………………………………………………………………………۱۲۹
بند اوّل: کمک تصاویر به درک بهتر مفاهیم اساسی و کلیدی محتوا…………………………………۱۳۰
بند دوم: جذابیت تصاویر………………………………………………………………………………………….۱۳۰
بند سوم: تناسب با فهم مخاطب………………………………………………………………………………….۱۳۱
بند چهارم: توجّه به شئون اجتماعی، اسلامی و فرهنگی…………………………………………………..۱۳۱
 تصویر درباره جامعه شناسی و علوم اجتماعی
نتیجه گیری…………………………………………………………………………………………………………۱۳۳
پیشنهادات…………………………………………………………………………………………………………..۱۳۴
منابع…………………………………………………………………………………………………………………..۱۳۵
مقدمه
۱٫ بیان مساله
تعلیم و تربیت صحیح، مهم ترین عامل در پیشگیری از وقوع جرم محسوب می شود. یکی از مهم ترین نهادهای مؤثّر در تعلیم و تربیت کودکان و نوجوانان و جامعه پذیری صحیح آن ها، نهاد آموزش و پرورش و به طور خاص نهاد مدرسه می باشد. این نهاد برای اعمال اصول تربیتی موردنظر خود، از ابزارهای متنوعی بهره می­گیرد که اساسی ترین آن ها، کتاب های درسی و محتوای آموزشی این کتب است که فراگیران از بدو یادگیری و افزایش رشد مهارت های شناختی خود با آن ها آشنا می شوند و آن را به عنوان منبع اصلی آموزشی ملاک عمل قرار می­ دهند. کتب مذکور تاثیر انکار ناپذیری بر روی شکل گیری شخصیت فرد و یاددهی هنجار­ ­­ها به وی و در نتیجه جامعه پذیری صحیح او دارد. از این رو محتوای آن ها باید به گونه ای باشد که جنبه ی پیشگیرانه از بروز ناهنجاری ها، انحرافات رفتاری و در نهایت جرم را در آینده داشته باشد.
آدرس سایت برای متن کامل پایان نامه ها
یکی از کتبی که فضای باز و مناسبی برای پرداختن به این قسم آموزه ها را دارا می باشد،کتب هدیه­های آسمانی دوره ابتدایی است که به لحاظ موضوع، قابلیت ارائه ی حجم مناسبی از مفاهیم پیشگیرانه از جرم را دارا می­باشد. اگر محتوای این کتب به صورت علمی بتوانند مفاهیم مذکور را در بر بگیرند، این مفاهیم از نخستین مراحل رشد شناختی کودک و نوجوان در وی نهادینه خواهد شد و این امر تاثیر بسیار زیادی بر جلوگیری از انحرافات در آینده بر روی وی خواهد داشت.
۲٫ سوالات تحقیق
۱٫ در متن کتب هدیه های آسمانی دوره ابتدایی تا چه اندازه به مفاهیم و آموزه های پیشگیرانه از جرم توجّه شده است؟
۲٫ مفاهیم پیشگیرانه موجود در کتب هدیه های آسمانی به لحاظ کیفیت و کمیّت در چه سطحی ارائه شده اند؟
۳٫ ضرورت تحقیق
با توجّه به تاثیرگذاری بسیار بالای کتاب هدیه های آسمانی بر روی عقاید، باورها و شخصیت کودک و نوجوان و نقش اساسی مفاهیم این کتب در تربیت اخلاقی و اجتماعی فرد و بهنجار کردن وی، لذا ضروری است که برای پیشگیری از انحرافات در آینده و جامعه پذیر کردن صحیح کودک و نوجوان، تجزیه و تحلیلی اصولی و علمی بر روی کمیّت و کیفیت مفاهیم پیشگیرانه از جرم این کتاب صورت بگیرد.
۴٫ اهداف تحقیق
۱٫ بررسی وجود یا عدم وجود مفاهیم پیشگیرانه از جرم در محتوای کتب هدیه های آسمانی دوره ابتدایی.
۲٫ بررسی کمیّت و کیفیت مفاهیم پیشگیرانه از جرم به کار رفته در کتب هدیه های آسمانی.
۵٫ فرضیه های تحقیق
۱٫ به نظر می رسد در کتب هدیه های آسمانی دوره ابتدایی، برخی مفاهیم پیشگیرانه از جرم وجود دارد.
۲٫ به نظر می رسد گرچه برخی مفاهیم پیشگیری از جرم در محتوای کتاب های هدیه های آسمانی وجود دارد اما از کمیّت و کیفیت مطلوب برخوردار نمی باشند.
۶٫ پیشینه تحقیق
طاهره بخشی پور در بررسی خود تحت عنوان تحلیل محتوای کتب فارسی دوره ابتدایی از نظر میزان ارتباط آن با مفاهیم آموزش شهروندی در دانشگاه علامه طباطبایی سال ۱۳۸۹ راهی نسبتا مشابه را پیموده است. سعدیه ندیمی نیز در پژوهشی تحت عنوان تحلیل محتوای کتب دوره ابتدایی از نظر توجّه به آموزش قانون گرایی در دانشگاه کردستان سال ۱۳۸۹ مسیری این چنین را طی کرده است. اگرچه پژوهش های دیگری نیز پیرو تحلیل محتوای کتب درسی صورت گرفته است ولی تا کنون پیشینه علمی مشخّصی در خصوص بررسی محتوای این کتب و از جمله ی آن­ها کتب هدیه های آسمانی از حیث توجّه به مفاهیم پیشگیرانه از جرم وجود ندارد.
۷٫ روش تحقیق
روش تحقیق در این پایان نامه همچون اکثر تحقیقات علوم انسانی به صورت توصیفی_تحلیلی است. به عبارت دیگر مطالعه ی منابع و فیش برداری به همراه تحلیل ونقد آنها و تجزیه و تحلیل داده ها، روش تحقیق در این پایان نامه می باشد. روش جمع آوری اطّلاعات نیز کتابخانه ای می­باشد.
۲
۸٫ سامانه تحقیق
تحقیق حاضر در قالب سه فصل ساماندهی شده است. فصل اوّل تحت عنوان کلّیات مشتمل است بر: تبیین مفاهیم موجود در قالب تعریف و تفسیر آن ها، بررسی جایگاه تعلیم و تربیت و نهاد آموزش و پرورش در پیشگیری از جرم و در آخر، روش شناسی تحقیق.
در فصل دوم تحت عنوان مبانی، به ذکر پایه های اساسی پرداخته ایم که ضرورت عطف توجّه به موضوع پژوهش را توجیه می کند. این فصل شامل چهار مبحث تحت عنوان: نقش کتب درسی در پیشگیری از جرم و به خصوص در پیشگیری رشدمدار از جرم، اسناد و قوانین داخلی و بین المللی در حوزه ی اهمیت آموزش و پرورش و محتوای کتب درسی و در نهایت نقش تحلیل محتوا در فرایند آموزش و طرّاحی کتب درسی، می باشد.
در فصل سوم تحت عنوان تجزیه و تحلیل محتوای کتب هدیه های آسمانی، در دو مبحث تجزیه محتوا و تحلیل محتوای کتب هدیه های آسمانی از حیث توجّه به مفاهیم پیشگیرانه از جرم، به بررسی کمیّت و کیفیت ارائه ی مفاهیم مذکور پرداخته ایم.
فصل اوّل
کلّیات

در فصل اوّل سعی شده است کلّیات موضوع تحقیق در سه مبحث: مفاهیم، تعلیم و تربیت و پیشگیری از جرم و روش شناسی تحقیق، ارائه شود.
مبحث اوّل : مفاهیم
در مواجهه با موضوعات مختلف، در خیلی از موارد در می یابیم که یکی از علل و موارد مهم مناقشه، ناسازگاری و چالش اذهان خوانندگان و شنوندگان و اطراف گفت و گو، بی توجّهی به معنا و مفهوم واژه های کلیدی است که بدون دریافت معنا و ادراک آن ها نمی توان به ماهیت اصلی مطلب پی برد. از سوی دیگر آشنایی خواننده با مفاهیم بنیادین به کار رفته در یک تحقیق شرط لازم برای فهم محتوای تحقیق می باشد. بنابراین برای فهم درست مباحث در هر زمینه و رشته ی علمی، پیش از هر اقدامی لازم است به بحث مفهوم شناسی توجّه کافی داشته باشیم.
گفتار اوّل : پیشگیری
در این گفتار به بررسی معنا و مفهوم پیشگیری و انواع آن خواهیم پرداخت.
بند اوّل: مفهوم پیشگیری
الف ) معنای لغوی:
پیشگیری از نظر لغوی معنایی روشن و پرکاربرد دارد. در ادبیات محاوره ای پیشگیری در معنای مانع وقوع امری شدن، جلوی وقوع امر ممکنی را گرفتن، به استقبال خطر رفتن و مانع تحقق آن شدن استعمال می شود. تعریف لغت شناسان نیز منطبق بر همین معنای عامیانه می باشد و پیشگیری را به معنای جلوگیری کردن، مانع شدن، منع کردن، به نگهداری برخواستن، از پیش مانع شدن از سرایت امراض و پیش بندی کردن مانند سیل یا جریان آب[۱]، دانسته اند.
ب) معنای اصطلاحی
پیشگیری در معنای اصطلاحی، با توجّه به فلسفه ی وجودی حقوق کیفری و راهکار های آن در برخورد با پدیده ی مجرمانه و همچنین گرایش های مختلف جرم شناسی، دارای دو مفهوم موسّع و مضیّق می باشد.

پایان نامه حقوق

۱-مفهوم موسّع
بر طبق مفهوم موسّع پیشگیری، هر اقدامی اعم از کیفری و غیر کیفری که در راستای مقابله با جرم و کاهش آمار جنایی صورت بگیرد در مفهوم پیشگیری می گنجد.کاربرد پیشگیری در این مفهوم به بکاریا برمی گردد با جمله مشهور «پیشگیری از وقوع جرایم بهتر از کیفر دادن است». وی آخرین فصل رساله جرایم و مجازات های خود را به پیشگیری از جرم اختصاص داده است.[۲] پس از وی انریکو فری، طیف وسیعی از تدابیر و اقدامات را به عنوان اقدامات پیشگیرانه معرفی می­ کند که از آن جمله است: آزادی داد و ستد برای جلوگیری از افزایش غیر طبیعی قیمت مواد خوراکی و جرائم مربوط به بازار سیاه، لغو انحصارات برای جلوگیری از قاچاق کالا، جانشین کردن طلا و نقره به جای اسکناس برای جلوگیری از جعل، ایجاد کوچه های پهن، بهبود روشنایی در شب ها برای جلوگیری از سرقت.[۳]
مفهوم موسع پیشگیری، امروزه نیز در ادبیات جرم شناسی به کار می رود. هیگ و رومانو پیشگیری را مشتمل بر آن دسته از تلاش هایی می دانند که یک یا چند مورد از جنبه های ذیل را در بر داشته باشد: وقوع رفتار نابهنجار را به تأخیر بیاندازند، آثار یک رفتار نابهنجار را کاهش دهند، آگاهی ها، نگرش و رفتارهایی را که باعث افزایش بهبود جسمی و عاطفی افراد می شود گسترش دهند و از سیاست های سازمانی اجتماعی و دولتی که بهبود وضعیّت جسمانی و روانی افراد را در پی دارد، حمایت کنند.[۴]
به طور کلی کاربرد غیر تخصصی واژه ی پیشگیری از جرم عمدتا درمعنای موسّع است.
۲-مفهوم مضیّق:
پیشگیری در معنای مضیّق علی القاعده طیف محدودتری از اقدامات را در برمی گیرد. از پیشگیری در معنای مضیق و یا در معنای خاص تعاریف متعددی ارائه شده است که به ذکر برخی از آن ها بسنده می کنیم.
ریموند گسن در یک تعریف بیان می کند پیشگیری مجموعه اقداماتی است به جز اقدامات کیفری، که هدف غایی آن، منحصرا یا به صورت جزئی محدود کردن دامنه ارتکاب جرم، غیر­ممکن کردن، مشکل کردن وکم کردن احتمال وقوع جرم باشد. از این رو، گسن پیشگیری را خارج از نظام کیفری متصور می شود. وی در سال ۲۰۰۲ تعریف دیگری از پیشگیری ارائه می­دهد که طبق این تعریف، پیشگیری مجموعه اقدامات و تدابیر غیر قهر آمیز است که با هدف خاص مهار بزهکاری، کاهش احتمال وقوع جرم و کاهش وخامت جرم، پیرامون علل جرائم اتخاذ می­ شود. در این تعریف اقدام پیشگیرانه، اقدام غیر قهر آمیزی است که بر عوامل جرم زا اعمال می­گردد.[۵]
با توجّه به تعاریف ذکر شده به طورکلی چهار ویژگی و مؤلّفه را می توان برای تدابیر پیشگیرانه در معنای خاص برشمرد:
۱٫ غیر قهر آمیز و غیر کیفری بودن: برای اعمال این اقدامات رضایت ذی نفع الزامی است. برخلاف ضمانت اجرای کیفری که یکسویه اعمال می گردد و مجرم در آن دخالتی نمی تواند بکند. اقدامات قهر آمیز، اصلاح و درمان معمول در حقوق جزا مشمول اقدامات پیشگیرانه نمی­ شود.
۲٫ اختصاصی بودن اقدامات پیشگیرانه: هدف و غایت اصلی این اقدامات باید به طور ویژه مربوط به پیشگیری باشد، نه این که پیشگیری، از آثار جنبی آن باشد.
۳٫ کاستن آثار جرم: اگر اقدامات پیشگیرانه نتواند جرم را محو کند، می بایست از شدت آثار و افزایش آمار آن بکاهد.
۴در نظر گرفتن عوامل خطر و محیط اجتماعی: تدابیر پیشگیرانه در معنای خاص، می بایست هم علل مستعد سازی بروز جرم ناظر بر شخص را در نظر بگیرد و هم ناظر بر محیط پیرامون فرد و عوامل جرم زا در این محیط باشد.
بند دوم: انواع پیشگیری از جرم

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:49:00 ب.ظ ]




در این شعر که شاعر در ماده تاریخ وفات جعفر قلی میرزا سروده است ضمن توصیف دو جهان او را پادشاه زادهای معرفی میکند که چون فرشته زیبارو است ایرج عم خود را به فرشتهای زیبارو مانند کرده است پس زن از حیث ظاهر مورد ستایش شاعر است که اگر بخواهند کسی را به زیبایی مثال بزنند نام او را متذکر میشوند.

۳- شراب
ابلیس شبی رفت به بالین جوانی آراسته با شکل مهیبی سر و بر را
گفتا که منم مرگ و اگر خواهی زنهار باید بگزینی تو یکی زین سه خطر را
یا آن پدر پیر خودت را بکُشی زار یا بشکنی از خواهر خود سینه و سر را
یا خود زمی ناب کشی یک دو سه ساغر تا آن که بپوشم زهلاک تو نظر را
گفتا پدر و خواهر من هر دو عزیزند هرگز نکنم ترک ادب این دو نفر را
جامی دو بنوشید و چو شد خیره زمستی هم خواهر خود را زد و هم کُشت پدر را
ای کاش شود خشک بن تاک و خداوند زین مایه شر حفظ کند نوع بشر را (ایرج میرزا، ۱۳۵۰، ص ۱۶۴)
شاعر ضمن بیان یکی از مشکلات جامعه که در قالب داستانی آن را مذمت میکند شاید سر مستی حکام را بیان میکند که به خاطر غفلت به انواع ظلم و ستم روی میآورند پس شعر مضمونی سیاسی و اجتماعی را تصویر میکند زن (خواهر) در این شعر برابر با پدر و عزیز و گرامی است که به خاطر اوضاع نابسامان جامعه حقوقش نادیده گرفته میشود و زیر پنجه مشکلات شخصیتش نابود و از بین میرود شاعر آرزو میکند که این مشکلات ریشه کن شود تا مردم جامعه در امان بمانند.
 تصویر درباره جامعه شناسی و علوم اجتماعی
۷- مرثیه
رسمست هر که داغ جوان دید دوستان رأفت برند حالت آن داغ دیده را
یک دوست زیر بازوی او گیرد از وفا وان یک زچهره پاک کند اشک دیده را
القصه هر کسی به طریقی زروی مهر تسکین دهد مصیبت بروی رسیده را
آیا که غم گساری و انده بری نمود لیلای داغ دیده زحمت کشیده را
بعد از پسر دل پدر آماج تیر شد آتش زدند لانه مرغ پریده را (ایرج میرزا، ۱۳۵۰، ص ۱۶۶)
در این شعر شاعر ضمن بیان شرح حال مصیبت دیده و کارهایی که دوستان برای تسلی خاطر او انجام میدهند حادثه کربلا را بیان میکند و به مادر علی اکبر که نماد صبر و شکیبایی است اشاره میکند او ضمن غمگساری برای این مادر او را موجودی رنج دیده معرفی میکند که بیش از همه از مرگ فرزند اندوهگین است و کسی او را تسلا نمیدهد.
از دید او زن روحیهای حساس و مهربان دارد که بیشترین آلام را تحمل میکند و ستودنی است.
۹- مرثیه
سرگشته بانوان وسط آتش خیام چون در میان آب نقوش ستارهها
اطفال خردسال زاطراف خیمهها هر سو دوان چو از دل آتش شرارهها
سبط شهی که نام همایون او برند هر صبح و ظهر و شام فراز منارهها
در خاک و خون فتاده و تازند بر تنش با نعلها که ناله بر آرد زخارهها (ایرج میرزا، ۱۳۵۰، ص ۱۶۷)
در این شعر که باز هم شاعر در سوگ شهیدان کربلا سروده است سرگذشت زنانی را بیان میکند که در میان آتش خیمهها مانند ستارهای بودند که در آب میدرخشیدند او ضمن بیان ستمی که بر اهل بیت رفت تصویر زنان حرم را تکان دهندهتر و تأثیر گذارتر به تصویر میکشد زن در اینجا نیز هم دوش مرد متحمل بار مشقت زندگی و پیرو امام و پیشوای خود است و حاضر است در راه دین و مولای خود در موج بلا بیفتد و شکایت هم نکند همانگونه که حضرت زینب بود.
۱۰- مادر
گویند مرا چو زاد مادر PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) به دهن گرفت آموخت
شبها بر گاهواره من بیدار نشست و خفتن آموخت
پس هستی من زهستی اوست تا هستم و هست دارمش دوست (ایرج میرزا، ۱۳۵۰، ص ۱۶۷)
ایرج در این قطعه مقام مادر و زن را ستوده است این قطعه بسیار نفیس و زیبا را ادوارد براون در صدر جلد چهارم تاریخ ادبیات ایران خود قرار داده است شاعر زحمات مادر را از ابتدای تولد کودک به تصویر میکشد و از نظر او زن موجودی تأثیرگذار است که پایه و اساس هستی میباشد.
۲۱- تاریخ فوت
این جهان پیش رادمرد حکیم هست محنت فزای غم آباد
زن و مرد و شه و گدا دارند همه از دست این جهان فریاد
پیر زالی است نو عروس نمای کرده در زیر خاک بس داماد (ایرج میرزا، ۱۳۵۰، ص ۱۷۱)
در این شعر که در تاریخ فوت یکی از شاه بانوان سروده شده است شاعر از فلک و زمانه گله میکند و اوضاع جهان را بر وفق حال هیچ کس نمیداند و جهان را چون پیرزنی میداند که خود را به شکل نوعروسی در میآورد تا بسیاری را به غرقاب فنا رهنمون سازد.
و سپس از فوت عزیز علیا (دختر شاه) سخن میگوید که اگرچه از دنیا رفته پا به بهشت نهاده است پس زن موجودی زمینی است که گاهی ستوده میشود و گاهی مورد مذمت قرار میگیرد.
۲۳- حق استاد
گفت استاد مبر درس از یاد یاد باد آنچه به من گفت استاد
هیچ یادم نرود این معنی که مرا مادر من نادان زاد (ایرج میرزا، ۱۳۵۰، ص ۱۷۲)
در این جا زن به عنوان مادر، کسی است که فرزند را به دنیا میآورد و به جهت تعلیم به نزد استاد میفرستد شاعر خود را مرهون زحمات استاد میداند و روان او را شاد میخواهد ایرج باز هم مقام مادر و زن را ستوده است.
۲۹- جواب به حامی عارف
میم سپاسی کجاست تا که نگویند عارف بیچاره دادخواه ندارد
تا که روان دیده اشک مام وطن را خنده شیرین و قاه قاه ندارد (ایرج میرزا، ۱۳۵۰، ص ۱۷۴- ۱۷۵)
او در این
شعر ضمن اعتراف به دوست داشتن عارف و پیام دادن به حامی عارف وطن را به مادر تشبیه میکند که نماد عشق سرشار است و این به جهت قداست بخشیدن به شخصیت زن است.
۳۰-
هر کس که نمود … دایم به … علیل باشد (ایرج میرزا، ۱۳۵۰، ص ۱۷۵)
شاعر ضمن بیان یکی از مشکلات اجتماعی که در اثر ارتباط نامشروع به وجود میآید از بی بند و باری بعضی انتقاد میکند که به زن به عنوان کالا نگاه میکنند در ضمن تیره روزی زنان آن روزگار که به دام افتادهاند را به تصویر میکشد.
۳۴- مهر مادر
رنج کشد مادر از جفای پسر لیک آنچه کشیدست هیچ رنج نداند (ایرج میرزا، ۱۳۵۰، ص ۱۷۷)
در این شعر شاعر ضمن ستایش مهر و محبت مادر که هیچ گاه مهرش را دریغ نمیکند زن را موجودی حساس و فداکار معرفی میکند.
۳۶- تصویر زن
در سر در کاروانسرایی تصویر زنی به گچ کشیدند (ایرج میرزا، ۱۳۵۰، صص ۱۷۷- ۱۷۸)
در اینجا شاعر از به تصویر کشیدن زنی صحبت میکند که به خاطر حفظ آبرو و دین تصویرش را با گل پوشاندند در واقع در این شعر نیز شاعر حجاب را مذمت و تمام گناهان و انحرافات را از رو پوشیدن بی مورد میداند او معتقد است که زن بدون حجاب نیز میتواند خود را حفظ کند و آسیب نبیند او از کج اندیشان و ظاهر بینان انتقاد میکند.
۳۸- بهشت و دوزخ
رسول دید که جمعی گسسته افسارند به چاره خواست کشان رِبقَه در رِقاب کند
برای ذوق تو شهوت پرست عبدالبطن حدیث میوه و حوریه و شراب کند (ایرج میرزا، ۱۳۵۰، ص ۱۷۹)
به نظر شاعر عذاب خداوند مختص به آن دنیا و بهشت و دوزخ نیست بلکه آنها را بیان میکند تا عدهای که ظاهر بین هستند پی به عذاب خداوند ببرند در اینجا حوریه مصداقی از زن است که در زیبایی و وجاهت بی نظیر است و پاداشی برای اعمال صالحان است.
۴۲- انتقاد از سازندگان آرام گاه فردوسی
یک وجب ساخته آخر نشود قبر حکیم شاید از خود دو سه پارک دگر آباد کنند
روح فردوسی از این زن جلبان در تعبست کاش این روح گرامی را آزاد کنند (ایرج میرزا، ۱۳۵۰، صص ۱۸۱- ۱۸۲)
شاعر ضمن انتقاد از حاکمان ظالم که فقط به فکر خود و خانواده هستند و به اسم ساختن بنا و تحت تأثیر قرار دادن مردم همه را به خانواده خود اختصاص میدهند از اوضاع نابسامان جامعه سخن میگوید و به عاملان حکومتی برای تحقیر فحشهای ناموسی نثار میکند و زن را تحقیر مینماید.
۴۴- در رثای کلنل محمد تقی خان
دلم به حال تو ای دوست دار ایران سوخت که چون تو شیر نری را در این کُنام کنند (ایرج میرزا، ۱۳۵۰، صص ۱۸۲- ۱۸۳)
شاعر در این شعر شخصیت کلنل محمد تقی خان را به خاطر کارهای شگرف و وطن دوستی دوستدار ایران لقب میدهد او مردان حکومتی را به عروسی تشبیه میکند و به گمان من به جهت تحقیر است که همطراز با زنان در نظر گرفته شدهاند او معتقد است که مادری نیست که فرزندی چون محمد تقی خان به دنیا آورد پس چنین مادری دارای قداست و زنی والا مقام است.
۴۷- تاریخ وفات عزیز علیا
یکی قمر طلعتی که بُد فرشته نهاد به عصمت و شرم او زنی به گیتی نبود (ایرج میرزا، ۱۳۵۰، صص ۱۸۴- ۱۸۵)
ایرج در این شعر به توصیف زن (عزیز علیا) میپردازد و او را با خاطر نسبت فامیلی میستاید و تاریخ فوت او را با شعر بیان میکند.
۵۴- مهر مادر
باز چون جوجه ماکیان بیند از پی صید برگشاید پر
پس روا باشد ار کنند اطفال جان به قربان مهربان مادر (ایرج میرزا، ۱۳۵۰، ص ۱۸۷)
در این شعر با بیان داستانی مهر مادر و عطوفت او را ذکر میکند زن موجودی فداکار است که بسیار شایسته تقدیر است.
۵۷- بامداد
دست مادر بوسد و روی پدر این در آغوشش کشد آن در کنار (ایرج میرزا، ۱۳۵۰، صص ۱۸۸- ۱۸۹)
در این شعر شاعر ضمن معرفی زن به عنوان مادر موضوع احترام و دست بوسی مادر را بیان میکند و همگان را به ارزش گذاری به مقام مادر تشویق میکند.
۵۸- مادر
پسر رو قدر مادر دان که دایم کشد رنج پسر بیچاره مادر (ایرج میرزا، ۱۳۵۰، صص ۱۸۹- ۱۹۰)
در این شعر نیز که در بزرگداشت و قداست مادر سروده شده است ضمن بیان مرارتهای مادر شخصیت او را میستاید و فداکاری او را متذکر میشود.
۶۵- قلب مادر

 

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:49:00 ب.ظ ]




عقل با عشق بر نمی آید جور مزدور می برد استاد (همان،۳۸۰)
عقل را گر هزار حجت است عشق دعوی کند به بطلانش (همان،۴۴۲)
عقل باید که با ضلالت عشق نکند پنجه ی توانایی(همان،۵۱۰)
ماجرای عقل پرسیدم ز عشق گفت معذور است و فرمانیش نیست (همان،۳۶۷)
شیخ اجل برای بزرگی عشق، در این میدان جنگ، عقل و عشق را به دو پادشاه تشبیه می کند که نمی توانند هم زمان در یک ناحیه حکومت کنند و برای بقای هر کدام، نابودی دیگری ضروری است، که عشق در این نبرد پیروز است و زمام امور را به دست می گیرد و می گوید:

فرمان عقل و عشق به یک جای نشنوند غوغا بود دو پادشاه اندر ولایتی (همان،۵۱۷)
در این کشور، عشق همه چیز را تحت کنترل خود می آورد و سعدی نیز معذور است و می گوید:
ملامتم نکند هر که معرفت دارد که عشق می بستاند ز دست عقل زمام(همان،۴۴۵)
امّا عشق در نظر سعدی، عشقی نیست که با معیار عقلی سنجیده می شود زیرا او بین عشق و شهوت ،عفت، نیکنامی و عافیت تفاوت قائل است و عشق را برتر از همه چیز می داند و می گوید :
سعدیا ،عشق نیامیزد و شهوت با هم پیش تسبیح ملائک نرود دیو رجیم (همان،۴۷۹)
سعدیا، عشق نیامیزد و عفت با هم چند پنهان کنی آواز دهل زیر گلیم (همان،۴۸۰)
عشق و دوام عافیت، مختلفند سعدیا هرکه سفر نمی کند دل ندهد به لشکری (همان،۵۲۵)
سعدیا، دور نیکنامی رفت نوبت عاشقی است یک چندی(همان، ۵۲۰)
با عنایت به آن چه بیان گردید عشق در کلام شیخ انواعی دارد که بیان مختصر آنان خالی از لطف نیست.
۳-۷-۵- انواع عشق در کلام سعدی
می دانیم که غزل سخن عشق و عاشقی است. عاشق در غزل از عشق خود سخن می گوید. تصویرهای مختلف معشوق، پرده وار در ذهن و دل عاشق نمایان می شوند.
چشم و ابرو، لب و دندان، زلف و گره، خط و خال، مهر و وفا، هجر و سوز، ناز و کرشمه و شور و شوق دلبر در غزل نمایان است و عاشق در طلب هر کدام لحظه شماری می کند. سعدی نیز غزل سرا است و قریب هفت صد غزل سروده است. در غزلیّات او همه نوع عشق دیده می شود زیرا اعتقاد دارد:
سخن بیرون مگوی از عشق، سعدی سخن، عشق است و دیگر قال و قیل است
(سعدی،۱۳۸۴،۳۵۲)
سخن سعدی عشقناک است. هر کس از دریچه ی چشم خود، در غزلیِّات سعدی، عاشق و معشوق را می یابد. امّا آن چه مسلّم است در نظر شیخ، عشق انواعی دارد که مختصراً به بیان آنان پرداخته می شود.
۳-۷-۵-۱- عشق به محبوب زمینی
سعدی به تناسب دردهای خود و اجتماع به توصیف معشوق زمینی می پردازد. او آن گونه که سزاوار دلبری دل کش است، معشوق را توصیف می کند. زیبایی، مهر، وفا و حالات مورد پسند عاشق را چنان به تصویر می کشد که خواننده را مجذوب بیان خود و زیبایی معشوق می نماید. سعدی عشق به محبوب زمینی را تنها مایه ی حسادت خود می خواند و می گوید:
هرگز حسد نبردم بر منصبی و مالی الا بر آن که دارد با دلبری وصالی
دانی کدام دولت در وصف می نیاید چشمی که باز باشد هر لحظه بر جمالی(همان،۵۴۱)
گرچه آوردن همه ی غزل هایی که در ذکر یار سروده شده اند، امکان پذیر نیست. امّا جهت بیان مطلب، بعضی از آنان آورده می شود.
غزلی با مطلع :
گر جان طلبی فدای جانت سهل است جواب امتحانت (همان،۳۷۸)
ای که رحمت می نیاید بر منت آفرین بر جان و رحمت بر تنت (همان،۳۷۶)
چه لطیف است قبا بر تن چون سرو روانت آه اگر چون کمرم ،دست رسیدی به میانت
(همان،۳۷۸)
یک امشبی که در آغوش شاهد شکرم گرم چو عود بر آتش نهند، غم نخورم(همان،۴۶۳)
مرا راحت از زندگی دوش بود که آن ماهرویم در آغوش بود(سعدی ،۱۳۸۴، ۴۱۵)
این که تو داری قیامتست نه قامت وین نه تبسم که معجز است و کرامت(همان،۳۷۵)
نفسی وقت بهارم هوس صحرا بود با رفیقی دو که دایم نتوان تنها بود(همان،۴۱۵)
آن چه در غزل های سعدی دیده می شود، لذّتی است که از توصیف معشوق می برد. در بیان زیبایی ها و تصویر لذت عاشقانه، بسیار ساده و قابل فهم سخن می گوید به نحوی که هر خواننده ای از آن لذّت می برد. گاهی نیز تصویری زیبا از حالات و نیاز های عاشقانه ی عاشق ترسیم می کند. که خواننده نمی داند سعدی دل دادگی عاشق یا دلبری معشوق را وصف کرده است. به عنوان نمونه می توان غزلی با مطلع زیر را بیان نمود.
فراق را دلی از سنگ سخت تر باید مرا دلی است که با شوق بر نمی آید(همان،۴۲۳)
در نه بیت غزل، تمنا های عاشق به تصویر کشیده شده است و نیاز ها و بیان عشق و محبّت عاشق از زیبایی محبوب نمایان تر است. در دو غزل زیر نیز چنین است.
هر شب اندیشه ی دگر کنم و رای دگر که من از دست تو فردا بروم جای دگر(همان،۴۳۱)
یا:
میان باغ حرام است بی تو گردیدن که خار با تو مرا به که بی تو گل چیدن
(همان،۴۹۲)
در این نوع غزل ها، شیخ تمنّا ها، نیاز ها و حالات عاشقانه ی انسانی را بیان می کند که برای رسیدن به محبوب، همه ی رنج های جهان را به دل خریدار است و با سوز وگداز ناشی از عشق، دست و پنجه نرم می کند امّا با همه ی این درد ها لحظه ای محبوب را فراموش نمی کند. شیخ مانند دیگر انسان هاست و در سرشت او عشق به ودیعه گذاشته شده است. عشق به محبوب زمینی، راه عبور به مراحل تکامل انسانیّت را برایش هموار می کند و از همین رهگذر است که می توان اشعار عرفانی او را از کامل ترین و رساترین، نمونه ی غزل فارسی شناخت.
۳-۷-۵-۲- عشق به خدا
در غزلیّات او علاوه بر عشق، عرفان نیز جلوه گری می کند، امّا معمولاً در میان صدای رسای عاشق و زیبایی و عشوه گری معشوق و حسن گفتار عاشقانه ی شیخ، لایه ی زیرین سخنش ، که همان ع
شق به خداست کمتر دیده می شود. او به این نکته به درستی پی برده که ممکن است همه ی افراد نتوانند زیبایی معنوی کلامش را درک کنند. به همین دلیل است که گاهی سعدی، با چراغی روشن در وسط اشعار عاشقانه ایستاده است تا راهی روشن، برای خواننده نمایان سازد. او در غزلی که در وصف زیبایی بهار است می گوید:
ما را سر باغ و بوستان نیست هر جا که تویی تفرّج آنجاست

 

موضوعات: بدون موضوع  لینک ثابت
 [ 02:49:00 ب.ظ ]




روش  AHP :

روش AHP توسط فردی عراقی الاصل به نام ساعتی ، در دهه 1970 پیشنهاد شد .این روش مانند انچه در مغز انسان انجام می شود ، به تجزیه و تحلیل مسایل می پردازد . این روش تصمیم گیرندگان را قادر می سازد اثرات متقابل و همزمان بسیاری از وضعیت های پیچیده و نامعین را تعیین می کند(مومنی ،1387 ،ص 40).

روش AHP در سالهای اخیر از پیشرفت چشمگیری برخوردار بوده است . این روش تصمیم گیرنده را قادر می سازد تا در محیط های پیچیده تصمیم گیری که معیارها و گزینه های کیفی یا کمی مختلفی وجود دارند و تعداد تصمیم گیرندگان نیز زیاد است به نحو مطلوبی اتخاذ نماید .این روش تحلیلی است زیرا از اعداد استفاده می کند . در نتیجه می توان از استدلال منطقی و ریاضی در آن استفاده نمود و دیگر اینکه سلسله مراتبی است . این خصوصیت AHP آن است که یک فرایند می باشد یعنی در این روش تصمیمات مهم به سادگی اتخاذ نمی گردند و نیازمند آن هستند که افراد مختلف طی جلسات گوناگون به تبادل نظر بپردازند و برایند نظرات خود را به عنوان تصمیم نهایی اعلام نمایند(احمدی ، 1383 ،ص406).

فرایند تحلیل سلسله مراتبی یکی از روش های MADM می باشد که به منظور تصمیم گیری و انتخاب یک گزینه از میان گزینه های متعدد تصمیم با توجه به شاخصهایی که تصمیم گیرنده تعیین می کند به کار می رود (مهرگان ، 1387 ،ص165).

فرایند تحلیل سلسله مراتبی با تجزیه و تحلیل پیچیده و مشکل آنها را به شکلی ساده تبدیل می کند و به حل آنها می پردازد(ایران نژاد ، 1381،ص57).

به کار گیری این روش مستلزم چهار گام عمده زیر است :

گام (1) : مدلسازی ؛ در این گام مساله و هدف مورد نظر به صورت سلسله مراتبی از عناصر که با یکدیگر در ارتباط می باشند درمی آید که این عناصر تصمیم شامل” شاخصهای تصمیم گیری"و” گزینه های تصمیم “می باشند .

گام (2) : قضاوت ترجیحی ؛ مقایسه هایی بین گزینه های مختلف تصمیم بر اساس هر شاخص صورت گرفته و با انجام مقایسات زوجی اهمیت یک شاخص تصمیم نسبت به دیگری به دست می آید .

گام (3) : محاسبات وزنهای نسبی ؛ وزن و اهمیت  ” عناصر تصمیم ” نسبت به هم از طریق مجموعه ای از محاسبات عددی تعیین می شود .

گام (4) : ادغام وزنهای نسبی ؛ این گام به معنی رتبه بندی گزینه های تصمیم صورت می پذیرد(مهرگان ، 1387 ،ص165).

فرایند تحلیل سلسله مراتبی مبتنی بر سه اصل زیر است :

  • اصل ترسیم در خت سلسله مراتبی
  • اصل تدوین و تعیین اولویت ها
  • اصل سازگاری منطقی قضاوت ها
  • تعیین اولویت ها

    همانطور که قبلا بیان کردیم به دلیل دشوار بودن درک یک مساله به صورت کلی برای انسان باید آنها را به مسایل کوچکتر تفکیک نمود . با توجه به معیارهای موجود و انجام مقایسات زوجی بین آنها برتری یک گزینه نسبت به گزینه دیگر مشخص می شود . با وارد نمودن این نتایج به مدل های مختلف تصمیم گیری نتایج خوبی به دست خواهد آمد .

    2-6-7-3- سازگاری منطقی قضاوت ها :

    ذهن انسان می تواند به نحوی بین اجزا،رابطه برقرار کند که بین آن ها سازگاری و ثبات منطقی وجود داشته باشد . سازگاری در دو مفهوم به کار می رود :

    • ایده ها و اشیاء مشابه ، باتوجه به ارتباطشان ، در یک گروه قرار می گیرند . برای نمونه یک انگور و یک مهره ، از نظر معیار گردی ، در یک گروه قرار می گیرند ؛ ولی اگر معیار مورد نظر طعم باشد ، بین این دو ارتباطی وجود ندارد.
    • میزان ارتباط بین ایده های مختلف ، با توجه به معیار خاص آنهاست . این ارتباطات ، تأثیر نسبی اجزای هر سطح را به اجزای سطوح بالاتر نشان می دهد(مؤمنی، 1387 ،ص42).

.Thomas L.Saaty

بانک سپه شهرستان سمنان

موضوعات: بدون موضوع  لینک ثابت
[پنجشنبه 1400-03-06] [ 09:18:00 ق.ظ ]




تاریخچه هوش هیجانی

تصویر توضیحی برای هوش هیجانی

بحث های فلسفی در مورد رابطه بین تفکر و هیجان در فرهنگ مغرب زمین به بیش از 2000 سال قبل برمیگردد. دراین بخش فعالیت های روانشناسی از 1900 میلادی تاکنون را مورد اشاره قرار میدهیم این سالها را میتوان به 5 دوره تقسیم کرد.(سیاروچی،فورگاسومایر، 2009،1383)

1- سالهای 1969-1900 دوره ای که در آن مطالعات روانشناختی مربوط به هوش هیجانی جدا و مستقل از یکدیگرصورت میگرفت.

2- سالهای 1989-1970 دوره ای که طی آن روانشناسان به بررسی چگونگی تاثیر هیجان و تفکر بر یکدیگر می پرداختند.

3- سالهای 1993-1990 دوره ای که در آن هوش هیجانی به عنوان یک موضوع مورد مطالعه و تحقیق مطرح گردید.

4- سالهای 1997-1994 دوره ای که طی آن مفهوم هوش هیجانی رواج یافت.

5- ازسال 1998 تاکنون،دوران اخیر که دوران انجام مطالعات شفاف سازی در مورد مفهوم هوش هیجانی است. دوره ی اولین یعنی سالهای 1969-1900 دوره ای بود که تحقیقات پیرامون هوش وهیجان در حوزه های جداگانه صورت میگرفت در حوزه هوش اولین آزمونها ساخته و توسعه پیدا کردند  و در بررسی های مربوط به هیجانها  پژوهشگران درگیر موضوع مرغ و تخم مرغ بودند بدین ترتیب که شخصی که با یک موقعیت استرس آور مواجه میشود (برای مثال دیدن خرس) ابتدا پاسخ فیزیولوژیکی هیجان را از خود نشان می دهد ( مثلا افزایش ضربان قلب) و سپس احساس هیجان می کند یا ابتدا احساس هیجان در او شکل میگیرد و سپس تغییرات فیزیولوژیکی در او بروز پیدا میکند(گلمن،1998). دومین دوره یعنی سالهای 1989- 1970 دوره ای بوده که طی آن پیشرفت های چندی در زمینه ی هوش هیجانی  صورت گرفت. هوش و هیجان که قبلا حوزه های جداگانه ای بودند در این دوره در یک حوزه جدید به یکدیگر نزدیک شدندو حوزه جدیدی را به عنوان شناخت و احساس (تفکر و هیجان) تشکیل دادند.  در سال 1990 و در آغاز دوره ی سوم ، جان مایر و همکارش پیتر سالوی طرحهای پژوهشی زیادی  را تدوین نموده و نظریه رسمی هوش هیجانی  را ارائه دادند. در چهارمین دوره (1997-1994) یک سری رویدادهای غیر منتظره رخ دادند که منجر به رواج و گسترش بیش از پیش حوزه ی هوش هیجانی شد. در این دوره اصطلاح هوش هیجانی  با چاپ کتاب  پرفروش دانیل گلمن، رواج زیادی پیدا کرد. گلمن و سایرین این اصطلاح را دست مایه ی مطالعه های زیادی قرار دادند. در کتاب گلمن (1995) هوش هیجانی به عنوان بهترین عامل پیش بینی کننده ی موفقیت در زندگی معرفی شده بود که هر کسی میتواند به آن دست یابد و میتوان آن را یک خصیصه شخصیتی به حساب آورد. اکنون ما در دوره  پنجم قرار داریم که از سال 1998 آغاز شده است طی این دوره اصلاحات و پالایش های  متعددی در ابعاد نظری و پژوهش حوزه ی هوش هیجانی  به عمل آمده است. مقیاسهای جدیدی  برای اندازه گیری هوش هیجانی تهیه وپژوهشهای  بنیادی تری  در این حوزه انجام گردیده است(بانکسون،2010، 72).

نتیجه تصویری برای موضوع هوش

ارسطو میگوید:"عصبانی شدن آسان است – همه می توانند عصبانی شوند، اما عصبانی شدن در برابر شخصِ مناسب، به میزان مناسب، در زمان مناسب، به دلیل مناسب و به روش مناسب – آسان نیست” در سال 1990 دو نفر از روان شناسان دانشگاههای ییل و نیو همشایر – دکتر جان مایر و دکتر پیتر سالوی – دو مقاله علمی راجع به هوش هیجانی نوشته و منتشر کردند و بدین ترتیب  سازه ی ” هوش هیجانی” را وارد پیشینه روان شناسی نمودند. این محققان در ابتدا این سازه را به عنوان توانایی تنظیم و تمایز قائل  شدن بین هیجانها و احساسات خود و دیگران و استفاده از اطلاعات  حاصله برای کنترل اعمال و افکار خود تعریف نمودند(مایر و سالوی، 1997). روزنامه نگار و روان شناس  دیگری به نام دکتر دانیل گلمن در سال 1995 کتاب پرفروشی به نام “هوش هیجانی” نوشت و در آن کتاب ادعا نمود که مایر و سالوی مشترکا به صورت بندی و ارائه نظریه ی هوش هیجانی پرداخته اند . او هوش هیجانی را بعنوان : آگاهی نسبت به هیجانهای خود، مدیریت هیجانها ، برانگیختن خود ، شناسایی هیجانهای دیگران ، و تنظیم روابط با دیگران تعریف نمود. امروزه از انواع مختلف و متعدد هوش صحبت می کنیم. در هر مورد هوش به توانایی دریافت، درک و کاربرد نمادها و سمبلها که نوعی توانایی انتزاعی است اشاره دارد تعریف اولیه ی هوش هیجانی برای اولین بار در سال 1990 با همکاری پیتر سالوی مطرح شد.اولین تعریف هوش هیجانی چنین بود: نوعی پردازش اطلاعات هیجانی  که شامل ارزیابی صحیح هیجانها در خود و دیگران و بیان مناسب هیجانها و تنظیم سازگارانه هیجانها است به نحوی که به بهبود جریان زندگی منجر شود. در سال 1999 میلادی جان مایر و همکارانش این تعریف را کمی مفصل تر کردند بدون اینکه به ساختار آن لطمه ای وارد شوداین تعریف چنین است: هوش هیجانی به توانایی شناسایی و تشخیص مفاهیم  و معانی هیجانها و روابط بین آنها ، استدلال کردن در مورد آنها و نیز حل مسائل بر اساس آنها اشاره دارد.

Gelman

Feeling

Excitement

موضوعات: بدون موضوع  لینک ثابت
 [ 09:16:00 ق.ظ ]




در اصلاحیه ای که از طرف گلمن بر تعریف فوق الذکر صورت گرفت هوش هیجانی به پنج حوزه تبدیل شد که عبارتند از:

تصویر توضیحی برای هوش هیجانی

  1. آگاهی از هیجانهای خود
  2. مدیریت هیجانها
  3. برانگیختن خود
  4. شناسایی هیجانهای دیگران
  5. تنظیم روابط خود با دیگران(لارسن، 2011، 24).

 

2-1-3- تعریف هوش هیجانی

دو حوزه ی  متفاوت “هیجان” و “هوش” به کمک هم  سازه ی  هوش هیجانی  را میسازند. هوش هیجانی مشتمل بر توانایی آگاهی نسبت به هیجانها و استفاده از آنها برای افزایش کیفیت زندگی شخصی و اجتماعی است در واقع میتوان گفت که هوش هیجانی شامل توانایی ادراک و بیان دقیق هیجانها استفاده از آنها برای تسهیل افکار و فهم هیجانها مدیریت کنترل آنها برای رشد هیجانی است البته تعدادی  مفاهیم دیگر شامل شایستگی هیجانی، خلاقیت هیجانی ، دقت همدلی، نیز به طور نسبی توسط صاحب نظران و محققان تا کنون برای شرح و توصیف این سازه استفاده شده اند. علیرغم الگوها و نظریات مختلفی که در باب ابعاد و روش های اندازه گیری هوش هیجانی وجود دارد، اغلب نظریه پردازان طی سالهای اخیر حداقل بر سر یک موضوع اتفاق نظر دارند و آن اینکه هوش هیجانی به موضوعی محوری برای محققان و مشاوران مدیریتی تحصیلی و روانی تبدیل شده است این اهمیت بر اساس شواهدی که طی این فصل مرور خواهد شدبه خوبی در دنیای کار و در سازمانها نیز رخنه نموده است(هریس، 2012، 45).

 تصویر درباره جامعه شناسی و علوم اجتماعی

 

2-1-3-1- تعریف هیجان

در فرهنگ های لغت تعاریف گوناگون  و متناقضی از هیجان وجود دارد یکی از تعاریفی که در اینجا به کار ما می آید و تا اندازه ای  وافی به مقصود است ، هیجان را نوعی حالت احساسی می داند که خودآگاه و ارادی است و طی آن حالتهایی چون شادی ، غم و غصه ، ترس ، تنفر و … تجربه میشوند  و با حالتهایی چون  شناخت  یا انگیزش و اراده تفاوت دارند( فرهنگ لغت راندم هاووس، 1973،ص270 نقل از سیاروچی، فورگاس و مایر،2009،1383). با مقایسه تعاریف گوناگون در می یابیم که هیجان  با شناخت (تفکر) و اراده(آرزوها و انگیزه ها) تفاوت دارد.

دانلود تحقیق و پایان نامه

 

 

2-1-3-2- تعریف هوش

هوش به صورتهای گوناگونی تعریف شده است. بهترین تعریفی که از هوش وجود دارد و در اینجا  برای هدف ما مناسب است. هوش را” مجموعه ای  از تواناییها ی شناختی  که به ما اجازه می دهند تا نسبت به جهان اطرافمان آگاهی  پیدا کنیم یاد بگیریم و مسائل را حل کنیم” تعریف کرده است. هوش توانایی ذهنی است و قابلیت‌های متنوعی همچون استدلال، برنامه‌ریزی، حل مسئله، تفکر انتزاعی، استفاده از زبان، و یادگیری را در بر می‌گیرد. نظریه‌های هوش در طول تاریخ تغییر کرده‌اند(باتلر و همکاران،2009، 10).

نتیجه تصویری برای موضوع هوش

 

Emotional Competence

Emotional Creativity

Accurate empathy

موضوعات: بدون موضوع  لینک ثابت
 [ 09:15:00 ق.ظ ]




در سنجش‌های سنتی تر تیزهوشی، افرادی که میزان ضریب هوشی (هوشبهر - IQ) آن‌ ها از حد مشخصی بیشتر باشد تیزهوش نامیده می‌شوند. این حد مشخص در نمونه گیری‌های مختلف، با توجه به نوع آزمون و جامعه آماری که ضریب هوشی به صورت نسبی نسبت به آن سنجیده می‌شود متفاوت است. اما باز هم به صورت معمول می‌توان 120 را عددی دانست که در بیشتر آزمون‌ها مرز تیزهوشی فرض می‌شود و به افرادی که ضریب هوشی بیش از این مقدار را داشته باشند تیزهوش گفته می‌شود(همان،11).

دانلود تحقیق و پایان نامه

 

2-1-5- تعریف روانشناختی هوش هیجانی

تصویر توضیحی برای هوش هیجانی

هوش هیجانی را باید ترکیبی از دو حالت از سه حالت ذهن دانست. هوش هیجانی به وسیله مایر و سالوی (1997) این گونه تعریف شده است"هوش هیجانی عبارتست از توانایی ادراک هیجانها ، جهت دست یابی به هیجانی سازنده  که به کمک آنها بتوان به ارزیابی افکار فهم هیجانها و دانش هیجانی  خود پرداخت  و با بهره گرفتن از آن بتوان موجبات پرورش احساسات و رشد  هوشی خود را فراهم ساخت. درک این نکته  که هوش هیجانی  نقطه مقابل یا در تضاد با هوش شناختی نیست و در آن مغز بر قلب چیره نمی گردد بسار مهم است.در هوش هیجانی مغز و قلب  یا هوش و هیجان به صورتی یگانه با یکدیگر تر کیب میشوند(نقوی، 1389، 37).

نتیجه تصویری برای موضوع هوش

با توجه به این مطالب میتوان ادعا نمود که هوش هیجانی عبارتست از استفاده از هیجانها  برای حل مسائل و داشتن یک زندگی مفید، خلاقانه و سازنده هوش هیجانی بدون هوش یا هوش شناختی بدون هوش هیجانی تنها بخشهایی ناقص از یک راه حل هستند. در اینجا مغز و قلب هر دو به کمک  هم میشتابند و با هم یکی میگردند(هارول،2009، 38).

 

2-1-6- تحلیل مولفه های هوش هیجانی

هوش هیجانی (یا هوش احساسی یا هوش عاطفی که با حروف اختصاری EQ نشان داده می‌شود) بخش مهمی از «هوش» است که شامل توانایی شناخت، درک و تنظیم هیجان‌ها (احساسات) و استفاده از آنها در زندگی است. اصطلاح هوش هیجانی اولین بار در سال 1990 روانشناسی بنام سالوی برای بیان کیفیت و درک احساسات افراد، همدردی با احساسات دیگران و توانایی اداره مطلوب خلق و خو به کاربرد. هوش هیجانی از چهار مهارت اصلی تشکیل می شود:1- خودآگاهی: توانایی شناسایی دقیق هیجان های خود و آگاهی از آنها به هنگام تولید. خودآگاهی، کنترل تمایلات خود درنحوه واکنش به اوضاع و افراد مختلف را نیز شامل می شود. فردی که از هوش هیجانی بالایی برخوردار است، نسبت به احساسات خود، آگاهی بی واسطه و بدون وقفه دارد.2- خود مدیریتی: یعنی اینکه بتوانید واکنش های هیجانی خود را در مقابل همه مردم و شرایط مختلف کنترل کنید. 3- آگاهی اجتماعی: توانایی در تشخیص دقیق هیجانات دیگران و درک اینکه دقیقاً چه اتفاقی در حال روی دادن است. این موضوع اغلب به این معناست که طرز تفکر و احساسات دیگران را درک می کنید، حتی زمانی که خودتان همان احساسات یا تفکرات راندارید و این همان همدلی است. 4- مدیریت اجتماعی: توانایی در به کارگیری ((آگاهی از هیجانات دیگران)) به منظور موفقیت درکنترل و مدیریت تعامل ها، همچنین این توانایی، ارتباط واضح با شرایط و کنترل موثر تعارض های دشوار را شامل می شود(برمن، 2010، 49).

 تصویر درباره جامعه شناسی و علوم اجتماعی

2-1-7- عوامل مؤثر در هوش هیجانی

سالووی توصیف مبنایی خود را از هوش هیجانی، بر اساس نطریات گاردنر درباره استعداد های فردی قرار می دهد و این توانایی ها را به پنج حیطه اصلی گسترش می دهد.

Consciousness

Self-management

Social Awareness

Social Management

موضوعات: بدون موضوع  لینک ثابت
 [ 09:13:00 ق.ظ ]




عوامل مؤثر در هوش هیجانی

تصویر توضیحی برای هوش هیجانی

سالووی توصیف مبنایی خود را از هوش هیجانی، بر اساس نطریات گاردنر درباره استعداد های فردی قرار می دهد و این توانایی ها را به پنج حیطه اصلی گسترش می دهد.

دانلود پایان نامه

    • شناخت عواطف شخصی : خود آگاهی(تشخیص هر احساس به همان صورتی که بروز می کند)سنگ بنای هوش هیجانی است .توانایی نظارت بر احساسات در هر لحظه برای به دست آوردن بینش روان شناختی و ادراک خویشتن نقشی تعیین کننده دارد.ناتوانی در تشخیص احساسات راستین، ما را به سردرگمی دچار می کند.افرادی که نسبت به احساسات خود اطمینان بیشتری دارند، بهتر می توانند زندگی خویش را هدایت کنند.این افراد درباره احساسات واقعی خود در زمینه اتخاذ تصمیمات شخصی از انتخاب همسر آینده گرفته تا شغلی که بر می گزینند، احساس اطمینان بیشتری دارند(شیروانی، 1388، 27).
    • به کار بردن درست هیجان ها: قدرت تنظیم احساسات خود، توانایی ای است که بر حس خود آگاهی متکی می باشد.که شامل ظرفیت شخص برای تسکین دادن خود، دور کردن اضطراب ها، افسردگی ها یا بی حوصلگی های متداول و پیامد های شکست در این مهارت عاطفی، است.افرادی که به لحاظ این توانایی ضعیفند، دایما با احساس نومیدی و افسردگی دست به گریبانند، در حالی که افرادی که در آن مهارت زیادی دارند، با سرعت بسیار بیشتری می توانند ناملایمات زندگی را پشت سر بگذارنند.

عکس مرتبط با افسردگی در روانشناسی Psychological depression

    • برانگیختن خود: برای عطف توجه، برانگیختن شخصی، تسلط بر نفس خود، و برای خلاق بودن لازم است سکان رهبری هیجان ها را در دست بگیرید تا بتوانید به هدف خود دست یابید.خویشتن داری عاطفی- به تاخیر انداختن کامرواسازی و فرونشاندن تکانش ها -زیر بنای تحقق هر پیشرفتی است.توانایی دستیابی به مرحله غرقه شدن در کار، انجام هر نوع فعالیت چشم گیر را میسر می گرداند.افراد داری این مهارت، در هر کاری که بر عهده می گیرند بسیار مولد و اثر بخش خواهند بود(همان،29) .
    • شناخت عواطف دیگران : همدلی، توانایی دیگری که بر خود آگاهی عاطفی متکی است اساس “مهارت ارتباط با مردم” است. افرادی که از همدلی بیشتری برخوردار باشند، به علایم اجتماعی ظریفی که نشان دهنده نیاز ها یا خواسته های دیگران است توجه بیشتری نشان می دهند.این توانایی آنان را در حرفه هایی که مستلزم مراقبت از دیگرانند، تدریس، فروش و مدیریت موفق تر می سازد.

 تصویر درباره جامعه شناسی و علوم اجتماعی

موضوعات: بدون موضوع  لینک ثابت
 [ 09:12:00 ق.ظ ]




هوش هیجانی در حوزه های مختلف:

تصویر توضیحی برای هوش هیجانی

تا کنون از هوش هیجانی در زمینه های آسیب شناسی روانی ، تعلیم و تربیت ، روابط بین فردی، رضایت حرفه ای و شغلی، سلامت جسمی ، فعالیتهای اقتصادی و تجاری و بهزیستی روانی  استفاده شده است. در این قسمت به صورت اجمالی این حوزه ها را مورد اشاره قرار می دهیم.

 

الف) هوش هیجانی در تفکر و رفتار اجتماعی:

 تصویر درباره جامعه شناسی و علوم اجتماعی

مطالعه و بررسی هیجانها و احساسات به عنوان آخرین حد تلاش برای درک ، فهم و علت پویایی رفتار انسان از جمله موضوعهای بسیار مهم میباشد. گرچه ما میدانیم  که احساسات و خلق و خوی ما می توانند تاثیر اساسی بر حیات ذهنی و اعمال و رفتار ما داشته باشند اما تا این اواخر آگاهی کاملی  نسبت به چگونگی  و چرایی این تاثیرات نداشته ایم  مولفه های  مهم و اساسی هوش هیجانی آگاهی نسبت به نحوه تاثیر هیجانها بر کنش و عملکرد و آگاهی  از چگونگی کنترل آنها میباشد(علاقبند، 1387، 16).

آنچه ما اکنون در مورد نقش هیجان بر شناخت و رفتار اجتماعی می دانیم حاصل تلاشهای مربوط به دو دهه گذشته می باشد. مطالعات جدید نشان داده اند که بر خلاف باور اغلب فلاسفه و روان شناسان شناخت وهیجان مستقل و جدای از یکدیگر نیستند. بلکه ارتباط و پیوستگی های زیادی  بین احساسات و افکار  در حیات اجتماعی  انسان وجود دارد . هیجان میتواند هم بر فرایند تفکر ( چگونگی برخورد ما با اطلاعات اجتماعی) و هم بر محتوای تفکر قضاوت ها  و رفتار ها ( آنچه ما فکر میکنیم  و عمل می نماییم) اثر بگذارد. در مجموع هیجان بر بیشتر رفتارهای ارتباطی ، گروهی ، تصمیم های سازمانی، رفتارهای مرتبط  با سلامتی و بهداشت  و حتی خریدهای روزانه ی افراد تاثیر می گذارد و هوش هیجانی  لزوما شامل آگاهی از چگونگی و زمانی که این تاثیرات  صورت میگیرد ، نیست ( رضایی، 1389، 15).

 

ب)هوش هیجانی و اختلالات  روانی:

امروزه این باور وجود دارد که اگر افراد از هوش هیجانی بالایی برخوردار باشند.می توانند با مشکلات و چالشهای زندگی  بهتر سازگار شوند و به گونه ای موثر با کنترل هیجانات خود کنار بیایند و به این ترتیب  موجبات بهبود و افزایش سلامت روانی خود را فراهم آورند. از طرف دیگر هوش هیجانی پایین می تواند یک عامل بالقوه تهدید کننده ی سلامت روانی باشد. اگر فرد قادر به تعریف و شناسایی هیجانهای خود و دیگران  باشد می تواند به خود آگاهی بالایی دست پیدا کند و خود را بهتر بشناسد چگونگی واکنش فرد به فشار های روانی شاخص مهمی از هوش هیجانی  وی به شمار میرود. اعتقاد رایج این است که اگر شما از هوش هیجانی بالایی برخوردار باشید می توانید  پاسخ های هیجانی خود را غنی تر و متعادل تر سازید و خودتان را از شر عوارض منفی استرس ها مصون نگه داریداز طرف دیگر آنانی که از هوش هیجانی پایینی برخوردار هستند دائم احساس پوچی و در هم شکستگی می نمایند و واکنش های هیجانی نامطلوبی نشان می دهند  و مبتلا  به انواع اختلالات جسمی  یا روانی می باشند(کریمی، 1387، 21).

 

ج)هوش هیجانی در تعلیم و تربیت:

به اعتقاد صاحب نظران هوش هیجانی و تحصیل ، هر دو یک مسیر و در راستای نیل به یک هدف قرار دارند به عبارت دیگر این دو در عرض یکدیگر قرار دارند و به موازات هم پیش میروند و یک نوع همگرایی بین تلاشهای معطوف به پرورش هوش هیجانی و فعالیتهای تحصیلی وجود دارد . لازم است تا کودکان را افرادی آگاه و مسئولیت پذیر تربیت کنیم تا بتوانند با هیجانهای خود به خوبی سازگار شوند و با آن کنار بیایند. نظامهای آموزشی ما باید تلاش نمایند تا تمامی  این ویژگیها را بصورت یک جا و کامل در دانش آموزان ایجاد و پرورش دهند(نیاز، 1389، 14).

 

 

د)هوش هیجانی در محیط کار:

شناسایی  هیجانها موجب کسب آگاهی نسبت  به آنها شده ، زمینه ی درک صحیح  هیجانهای دیگران را فراهم  می نماید. کاربرد هیجانها  موجب تولید عقاید و بروز یک احساس  یا تقویت روح همکاری گروهی است. درک و فهم هیجانها موجب کسب بینش نسبت به انگیزه های  افراد شده ما را نسبت  به نقطه نظر ما و دیدگاه های دیگران آگاه تر می نماید در نهایت مدیریت  هیجانها  به ما اجازه می دهد تا هیجانهای خود را بپذیریم  و از اطلاعات ارزشمند بدست امده از آنها به صورت سازنده ای استفاده کنیم. نا رضایتی از شغل ممکن است از خود شغل ، از محیط  یا از خود شخص ( صفات شخصیتی هم چون تحمل استرس و افسردگی ) باشد. در بیشتر موارد فرار افراد از موقعیت  صرفا  به دلیل بازآفرینی و تجربه ی موقعیت نا مطلوب مشابه در یک محیط جدید میباشد. تعجبی ندارد اگر گفته شود که مهارتهای هیجانی  و  اجتماعی  بخش مهمی از توانایی های  افراد برای احراز شغلی است که طالب آن هستند.پژوهش جدیدی که توسط  کینگز بوری و داوس ، انجام شده نشان میدهد که مدیریت  هیجان در موفقیت  در جریان مصاحبه شغلی تاثیر زیادی دارد .کالدول و برگر دریافتند که بین ویژگی برون گرایی و خوشرویی با پذیرفته شدن در شغل مورد علاقه ارتباط زیادی وجود دارد(اکبری، 1388، 9).

تصویر مرتبط با افسردگی در روانشناسی Psychological depression

King bags and Davos

موضوعات: بدون موضوع  لینک ثابت
 [ 09:10:00 ق.ظ ]




هوش هیجانی در محیط کار:

تصویر توضیحی برای هوش هیجانی

شناسایی  هیجانها موجب کسب آگاهی نسبت  به آنها شده ، زمینه ی درک صحیح  هیجانهای دیگران را فراهم  می نماید. کاربرد هیجانها  موجب تولید عقاید و بروز یک احساس  یا تقویت روح همکاری گروهی است. درک و فهم هیجانها موجب کسب بینش نسبت به انگیزه های  افراد شده ما را نسبت  به نقطه نظر ما و دیدگاه های دیگران آگاه تر می نماید در نهایت مدیریت  هیجانها  به ما اجازه می دهد تا هیجانهای خود را بپذیریم  و از اطلاعات ارزشمند بدست امده از آنها به صورت سازنده ای استفاده کنیم. نا رضایتی از شغل ممکن است از خود شغل ، از محیط  یا از خود شخص ( صفات شخصیتی هم چون تحمل استرس و افسردگی ) باشد. در بیشتر موارد فرار افراد از موقعیت  صرفا  به دلیل بازآفرینی و تجربه ی موقعیت نا مطلوب مشابه در یک محیط جدید میباشد. تعجبی ندارد اگر گفته شود که مهارتهای هیجانی  و  اجتماعی  بخش مهمی از توانایی های  افراد برای احراز شغلی است که طالب آن هستند.پژوهش جدیدی که توسط  کینگز بوری و داوس ، انجام شده نشان میدهد که مدیریت  هیجان در موفقیت  در جریان مصاحبه شغلی تاثیر زیادی دارد .کالدول و برگر دریافتند که بین ویژگی برون گرایی و خوشرویی با پذیرفته شدن در شغل مورد علاقه ارتباط زیادی وجود دارد(اکبری، 1388، 9).

عکس درباره افسردگی Psychological depression

 

2-1-9- هوش عاطفی همان هوش هیجانی

هوش عاطفی، هوش احساسی یا هوش هیجانی (که ضریب آن با EQ نشان داده می شود) شامل شناخت و کنترل عواطف و هیجان‌های خود است. به عبارت دیگر، شخصی که EQ بالایی دارد سه مؤلفه هیجان‌ها را به طور موفقیت آمیزی با یکدیگر تلفیق می‌کند (مؤلفه شناختی، مؤلفه فیزیولوژیکی و مؤلفه رفتاری). دانیل گلمن معتقد است، هوش عاطفی بالا تبیین می‌کند که چرا افرادی با ضریب هوشی (IQ) متوسط موفق تر از کسانی هستند که نمره‌های IQ بسیار بالا تری دارند. ضریب هوشی(IQ) نمی تواند بخوبی از عهده توضیح سرنوشت متفاوت افرادی بر آید که فرصت ها، شرایط تحصیلی و چشم اندازهای مشابهی دارند.وقتی نود و پنج دانشجوی دانشگاه هاروارد در دهه 1940 را  یعنی دورانی که دانشجویان دانشگاه های شرق آمریکا را اقرادی با هوشبهرهای متنوع تر از امروز تشکیل می دادند  تا سنین میانسالی مورد بررسی قرار دادند، چنین دیدند که افرادی که بالاترین نمره های تحصیلی را داشتند از نظر میزان حقوق دریافتی، بهره وری و موفقیت شغلی از همدوره ایهای ضعیف تر خود موفق تر نبودند. آنان حتی از نظر میزان رضایت از زندگی شخصی یا رضایت از روابط دوستانه، خانوادگی و عشقی نیز وضعیتی برتر نداشتند. با ظهور عصر اطلاعات و ارتقاء ارزش مندی ارتباطات انسانی و هم چنین بروز موقعیت‌های استراتژیک سازمانی، نظریه هوش عاطفی رشد چشم گیری یافته و از مباحث پرطرفدار سازمانی شده‌است. هوش هیجانی، اصطلاح فراگیری است که مجموعه گسترده‌ای از مهارت‌ها و خصوصیات فردی را در برگرفته و معمولاً به آن دسته مهارت‌های درون فردی و بین فردی اطلاق می‌گردد که فراتر از حوزه مشخصی از دانش‌های پیشین، چون هوشبهر و مهارت‌های فنی یا حرفه‌ای است. هوش هیجانی از آخرین مباحث متخصصین در خصوص درک تمایز بین منطق و هیجان بوده و برخلاف مباحث اولیه در این جا، فکر و هیجان به عنوان موضوعاتی برای سازگاری و هوش مندی تلقی شده است. به علاوه، شبیه سایر مباحث مطرح درخصوص ماهیت انسان، هوش هیجانی نیز دستخوش دو نوع بحث و گفتگوی علمی و عوام پسند گردیده‌است. اصطلاح هوش عاطفی برای اولین بار در دهه 1990 توسط دو روان شناس به نام‌های جان مایر و پیتر سالووی مطرح شد. آنان اظهار داشتند، کسانی که از هوش هیجانی برخوردارند، می‌توانند عواطف خود و دیگران را کنترل کرده، بین پیامدهای مثبت و منفی عواطف تمایز گذارند و از اطلاعات عاطفی برای راهنمایی فرایند تفکر و اقدامات شخصی استفاده کنند. دانیل گلمن صاحب نظر علوم رفتاری و نویسنده کتاب «کار کردن به وسیله هوش هیجانی» اولین کسی بود که این مفهوم را وارد عرصه سازمان نمود. گلمن هوش هیجانی را استعداد، مهارت و یا قابلیتی دانست که عمیقاً تمامی توانایی‌های فردی را تحت الشعاع قرار می‌دهد(توسکی، 1390، 3).

Efficiency بهره وری

King bags and Davos

موضوعات: بدون موضوع  لینک ثابت
 [ 09:09:00 ق.ظ ]




امروزه صاحب‌نظران علم مدیریت باوجودداشتن اختلاف نظر در زمینه‌های مختلف در این زمینه که مهم‌ترین سرمایه هر سازمان، منابع انسانی آن است هم عقیده‌اند. تجربه نشان داده است که توسعه منابع انسانی هرسازمان درواقع توسعه ظرفیت‌های کمی و کیفی آن سازمان به شمار می‌رود. درحال حاضر روش‌های متداولی در سازمان‌ها برای بهبود عملکردکارکنان وجود دارد که عموما هنگام پرداخت پاداش سالانه و اضافه حقوق به عنوان یک ضابطه مورد استفاده قرار می‌گیرند. اما متاسفانه نادرند موسساتی که ازآن به عنوان یک مکانیزم موثر در مدیریت نیروی انسانی و ازجمله برنامه‌ریزی نیروی انسانی،بالا بردن ظرفیت‌های انسانی سازمان،ایجادارتباط متقابل بین اداره‌کنندگان و اداره‌ شوندگان استفاده کنند. فرا تراز آنان جام ارزیابی عملکرد واحده است که درصورت یکه همزمان با ارزیابی عملکرد کارکنان انجام شود،می‌تواند نقش ارزنده‌ای در دستیابی به هدفهای شرکت ایفا نماید(دموند،2010،15).

عملکرد یکی از مهم ترین و اثر گذارترین پیشرفت ها در حوزه مدیریت منابع انسانی طی سالیان   اخیر می باشد. این اصطلاح ابتدا توسط بیر و راح در سال 1376 ابداع شد.اما تا اواسط دهه 1980، با عنایت بهاین مطلب که برای مدیریت و عملکرد و پاداش یک رویکرد مداوم تر و منسجم تر مورد نیاز می باشد، به صورت  یک رویکرد مجزا شناخته شده بود. عملکرد یک فرایند استراتژیک و منسجم می باشد که موفقیت پایدار سازمان ها را به وسیله بهبود عملکرد کارکنانشان از طریق توسعه توانایی تیم ها و افراد شرکت کننده تضمین می نماید (میر سپاسی، 1386، 20).

عکس مرتبط با منابع انسانی

 

2-2-2- تاریخچه پیدایش مدیریت منابع انسانی

اداره نیروی انسانی از قدیمی ترین مباحث بشری است زیرا از آن روزی که انسان حیات یافت و در زمین به تشکیل خانواده و اجتماعات اولیه همت گمارد، اندیشه اداره افراد خانواده یا جوامع اولیه در ذهن او مطرح شده است. واحدهای کوچک انسان اولیه مانند خانواده، قبیله و … گرچه دارای سادگی ویژه ای بودند و پیچیدیگی جوامع امروزی را نداشتند، اما به یک نفر اداره کننده که دیگران از قدرت فکری، جسمی، بیانی، سنی و رفتاری او متأثر باشند و ارشادات او را پذیرا باشند، نیازمند بوده اند.

به فرموده علامه طباطبایی «اولین کسانی که به طور گسترده آدمیان را به اجتماع آگاه ساختند و بطور مستقل  به حفظ اجتماع و ادارۀ انسانها توجه داشتند پیغمبران بودند»(سید جوادین،1387، 54). البته در جوامع قدیم نیز رشحاتی از توجه اداره نیروی انسانی وجود داشته است. «در رم باستان مدیر امور کارکنان موظف بودند که افراد مستعد را برای گلا ریا توری جذب نمایند، آنها را به درستی انتخاب نموده و تحت آموزش قرار دهند و وظایف آنها را مشخص نمایند. حتی نوع سیستم ارزیابی عملکرد و پاداش را پیش بینی کرده بودند که ضعیف ترین آدم یا آدمهایی فاقد تمایل را برانگیزانند» (سید جواد ین، 1387، 63).

ایرانیان باستان نیز جهت اداره انسانی به نکات عمده ای جهت رعایت روابط انسانی، رعایت عدالت در کار، آشنا سازی کارکنان به وظایف و استفاده بهینه از زمان، اشاره داشته اند چنان که گزنفون می نویسد:«تأکید به استفاده از طرح جا و مکان، مطالعه زمان و حرکت توسط کوروش پادشاه هخامنشی، اصولی بوده اند که او را در اداره کشور بزرگ ایران و ارتش نیرومندش یاری می داد» (کمال پرهیز کار،1385، 40).

در هر حال، هر چند فعالیتهای امور کارکنان ریشه در دوران باستان دارد و بشر همیشه با نوعی انتخاب، گزینش، ارزشیابی، جبران خدمت و … روبرو بوده است اما در حقیقت از اواخر قرن نوزدهم و اوایل قرن بیستم نخستین نشانه های مدیریت منابع انسانی به صورت تخصصی، در مدیریت مطرح گردید. (نمودار سیر تحول تدریجی مدیریت منابع انسانی را نشان می دهد.)

 

موضوعات: بدون موضوع  لینک ثابت
 [ 09:07:00 ق.ظ ]




تاریخچه و پیشینه عملکرد در مدیریت

عملکرد یا مدیریت بر مبنای واقعیات مفهوم جدیدی نیست. پس از جنگ جهانی دوم و قدرت گرفتن مدیران «ویزکیدز» در کمپانی خودروسازی فورد، شکلی از این مدیریت به وجود آمده که از داده های سازمان به صورت ابتکاری استفاده می کرد. با پیوستن یکی از مدیران ویزکیدز، به نام رابرت مک نامارا، به وزارت دفاع آمریکا، این روش مدیریت در طول جنگ ویتنام در پنتاگون شناخته شد.

با شروع مدیریت صنعتی توسط ادوارد دمینگ در دهه 1950 و کارهای وی با همکاری مدیران ژاپنی تحولی در کیفیت، ابتکار، قدرت کارکنان، بازخور و مدیریت بر مبنای عملکرد پدید آمد. افرادی نظیر پیتر دراکر، جوران، کرازبی و تام پیترز، فلسفه دمینگ را گسترش دادند. جهت شناسایی فصل ایجاد تغییرات و کنترل آنها در تولید و در نهایت بهبود محصول یا ارائه خدمات، دمینگ برای این امر تأکید دارد که کلیه فرآیندهای کسب و کار می بایست بخشی از سیستم عملکرد همراه با چرخه بازخور باشد(کریمی،1387،19).فلسفه دمینگ در ایالات متحده آمریکا در دو بخش آغاز شد: ارتش و شهرداری. در ارتش این فلسفه تحت برنامه مدیریت جامع کیفیت (TQM) و در شهرداری در قالب جایزه ملی مالکوم بالدریج شکل گرفت.

ارزیابی عملکرد در دولت ایالات متحده در قالب برنامه عملکرد و نتایج دولت آغاز شد. در این برنامه کلیه آژانس های دولتی می بایستی برنامه استراتژیک، اهداف عملکرد و شاخص های عملکرد را در طول زمان ارائه می دادند. بودجه این کار توسط دفتر مدیریت برای آژانس ها فرستاده می شد. (داریانی، رفیع زاده بقرآباد، رونق، 1386، 7).

 

2-2-4- عملکرد شغلی:

عملکرد یک سازه ترکیبی است که بر طبق آن کارکنان موفق به مجموعه ای از رفتارهای مشخص میشوند.(اسپکتور،2009،200)( مک کنزی، پود ساکف و فتر، 2010) بنابراین عملکرد شغلی یک ملاک چند گانه و گسترده است که در آن مجموع رفتارهایی که به دقت تعریف شده اند برای تعریف عملکرد مورد استفاده قرار می گیرد( گاسیکو، 2008).اطلاع دادن به افراد در مورد نحوه عملکردشان با تذکر به کاستی ها و کمبودها کمکی به بهبود کار آنان   می باشد و این عمل را همه افراد از کودکی تجربه نموده اند زیرا با حضور فرد در مدرسه و با کنترل تکالیف فرد توسط آموزگاران و دریافت کارنامه تحصیلی فرزندان توسط والدین از نتیجه عملکرد فرزندان آگاه شده و با اتخاذ تنبیه و تشویق به موقع زمینه پیشرفت و هدایت فرزندان فراهم می گردد.عملکرد نیروی انسانی یکی از مباحث کاربردی مدیریت منابع انسانی است و جایگاه ارزشمندی در بسیاری از تصمیم گیری های مدیریتی دارد در این قسمت ابتدا به تعریفعملکرداز دیدگاه چند نفر از صاحب نظران می پردازیم:

عکس مرتبط با منابع انسانی

 

  • اندرسن:

عملکرد بدون تردید برای پیشرفت مدیریت دستگاه حائز اهمیت است زیرا اگر نقاط قوت و ضعف کارکنان شناخته نشود، کوشش های مبتنی بر بهسازی در سازمان به ندرت در مسیر خود قرار دارد(صائبی، 1389، 252).

  • جک باتر ورت:

عملکرد شغلی عبارت است از انجام مشاغل با بهره گیری از یک نوع وسیله سنجش و سپس نوعی رتبه یا سلسله مراتب که در آن اهمیت نسبی هر کدام از مشاغل نسبت به دیگری دیده شود، تاکید عملکرد به شغل است و مشاغل (صائبی، 1389، 89).

  • دیوید کامرون:

عملکرد، فرآیندی است که طی آن سرپرستان گزارش دهی در خصوص عملکرد، پیشرفتها، توانایی ها، آمادگی برای موفقیتهای آتی و دیگر ویژگیهای کارکنان تحت پوشش خود می پردازند(صائبی، 1389، 251).

  • عملکرد کارکنان:

عبارتست از انجام سیستماتیک و نظم کار افراد در رابطه با نحوه انجام وظیفه آنها در مشاغل محوله و تعیین پتانسیل موجود در آنها جهت رشد و بهبود (میر سپاسی،1380، 222).

  • عملکرد:

فرآیندی است که به وسیله آن کار کارکنان در فواصلی معین و به طور رسمی، وظایف خ.د را انجام می دهند(سعادت،1375، 214).

تعریف دیگری که می توان از عملکرد ارائه نمود عبارتست از تعیین درجه کفایت و لیاقت کارکنان در انجام وظایف و مشاغل محوله و تقبل محدودیتها در سازمان که بطور عینی و سیستماتیک اجرا می گردد، به عبارت دیگر: عملکرد کارکنان در رابطه با نحوه انجام کار مشخص، در یک دوره زمانی معین، در مقایسه با استاندارد انجام کار و همچنین تعیین استعداد و ظرفیتهای بالقوه فرد، به منظور برنامه ریزی در جهت افزایش انگیزه و پویایی آنان. بنابراین عملکرد را می توان شناسایی میزان اثر بخشی و کارآمدی کارکنان سازمان بوسیله ایجاد توسعه اطلاعات حیاتی منابع انسانی دانست که خود سبب دستیابی به اهداف دیگری می شود. (علی غلامی،1389،32) .

- Peter Drucker

- j,m. Juran

-Peter Crosby

- Tom Peters

- Total Quality Management(TQM)

- Malkom Baldrige

- GovernmentPerformanceandResults(GPAR)

Jak- Butter worth

David Cameron

موضوعات: بدون موضوع  لینک ثابت
 [ 09:06:00 ق.ظ ]




سابقه ارزیابی عملکرد

اگر بخواهیم سابقه ارزیابی عملکرد را مورد کاوش قرار دهیم باید به تاریخ زندگی بشر باز گردیم، به اولین باری که افراد کار کردن به صورت گروهی را آغاز کردند. در آن دوران ارزیابی تنها بر اساس قضاوت های ذهنی و شخصی انجام می شد، اما به مرور زمان و در دوره های مختلف مدیریت و در کشورهای مختلف شیوه های مختلفی برای کنترل و ارزیابی عملکرد مورد استفاده قرار گرفت، چنانچه در مکتب مدیریت کلاسیک گرایش نظام های کنترل به سمت زمان سنجی کار و پیش بینی همه شرایط و نتایج دستیابی بود. نظام ارزیابی عملکرد برای اولین بار به صورت رسمی، در سطح فردی و سازمانی از سال 1800 میلادی توسط رابرت اون در اسکاتلند در صنعت نساجی مطرح گردید به طوری که کالاهای تولید شده با بهره گرفتن از چوبهایی در رنگ های مختلف درجه بندی می شدند که این کار در واقع نوعی ارزیابی از کیفیت و یا ستاده سازمان بوده است(داریانی، رفیع زاده بقرآباد، رونق،1386،6 ).

2-2-6- تجزیه و تحلیل مدیریت عملکرد

به منظور دستیابی به سیستم مدیریت عملکرد موفق، بایستی هم به کیفیت سیستم مدیریت عملکرد و هم به  محرک های رفتاری عملکرد توجه داشت. برای تحقق این دو هدف از تجزیه و تحلیل مدیریت عملکرد استفاده می شود. تجزیه و تحلیل مدیریت عملکرد هم به جنبه های رفتاری مدیریت عملکرد و هم به جنبه های ساختاری آن توجه می کند. جنبه ساختاری در مورد ساختاری بحث می کند که در اجرای مدیریت عملکرد مورد نیاز واقع می شود. این جنبه شامل عوامل کلیدی موفقیت، شاخص های عملکرد کلیدی و معمولاً کارت امتیازی متوازن می گردد. جنبه رفتاری، اعضای سازمان و استفاده آنها از سیستم مدیریت عملکرد را در بر می گیرد. جنبه های رفتاری، پیرامون طریقی که در آن اعضای سازمان مدیریت عملکرد را به کار می گیرند، بحث  کند. ابعاد تحلیل مدیریت عملکرد در جدول زیر به صورت خلاصه آمده (دی وال– گریتسن، 2006 ، 26).

 

جدول ابعاد تحلیل مدیریت عملکرد

تفسیر نوع ابعاد ردیف
* روش واضحی با مسؤولیتها و وظایف تعریف شده در تمام سطوح مدیریتی به کار بسته می شود. ساختاری ساختار مسئولیت 1
* اعضاء سازمان یک مجموعه از اطلاعات عملکردی مالی و غیر مالی را مورد استفاده قرار می دهند که تمرکز استراتژیک را از طریق به کار بستن <a href="https://www.sid.ir/fa/journal/ViewPaper.aspx?id=59237″ title=”عوامل بحرانی“>عوامل بحرانی و شاخص های کلیدی عملکرد، مقدور می سازد. ساختاری محتوا 2
* اطلاعات عملکرد بایستی، بروز، به موقع و سازگار باشند. ساختاری تمامیت (کمال) 3
* گزارش های مدیریت و سیستم های مدیریت عملکرد به صورت مشروح و مفصل مورد استفاده قرار گرفته و اطلاعات مشروح عملکرد به آسانی از طریق سیستم های ICT قابل حصول اند. رفتاری قابلیت مدیریت 4
* اعضای سازمان بایستی در مورد نتایج شاخص های کلیدی عملکرد حوزه مسئولیت شان و همچنین کل سازمان، احساس مسئولیت کنند. رفتاری پاسخگویی 5
* مدیریت ارشد آشکارا درگیر عملکرد سازمان می شود و مشوق فرهنگ قوی و الزامات رفتاری آن خواهد بود. رفتاری شیوه مدیریت 6
* اطلاعات عملکرد در فعالیت های روزانه اعضای سازمان ترکیب و ادغام می گردد. بنابراین لازم است که این اطلاعات از فعالیت ها استخراج شوند. رفتاری جهت یابی 7
* ارتباطات پیرامون نتایج (از بالا به پایین و از پایین به بالا) اطلاعات، دانش و عملکرد را تسهیم می کند. رفتاری ارتباطات 8
* سایر سیستم های مدیریت در سازمان از قبیل سیستم منابع انسانی، با مدیریت عملکرد تنظیم و هماهنگ می شوند. بنابراین آنچه که اهمیت می یابد اینست که سازمان به طور منظم ارزیابی می شود و بر اساس آن سیستم پاداش تنظیم گردد. _____ سازگاری و انطباق 9

 

مدیریان سازمان، این شاخص ها را برای هر یک از ابعاد نُه گانه فوق، از 1 تا 10 مقیاس بندی کرده و سپس بر اساس ایده شخصی خود مشخص می کنند که سازمان در کدام بعد ضعیف عمل نموده است. آنها همچنین در مورد هر یک از شاخص ها بیان می دارند که سازمان چگونه بایستی در آینده به سطح مطلوبی از عملکرد دست یابد.

indicators

- de Waal  

موضوعات: بدون موضوع  لینک ثابت
 [ 09:04:00 ق.ظ ]




جایگاه ارزیابی عملکرد و مدیریت عملکرد

هر چند مفاهیم مدیریت و ارزیابی غالباً به جای هم کار می روند، اما مدیریت عملکرد فرآیندی است که نه تنها ارزیابی عملکرد بلکه نظام های انضباطی و خط مشی های رسیدگی به شکایات را به عنوان ابزار مدیریت عملکرد در نظر می گیرد. علیرغم اینکه ارزیابی عملکرد، عایدات و منافع بسیاری را به همراه داشته است اما اثر بخشی کامل، هنگامی حاصل می شود که ارزیابی عملکرد، در بطن نظام مدیریت عملکرد، یکپارچه گردد.بردرآپ (1955) عناصر عملکرد را برنامه ریزی، اجرا و بکارگیری ارزیابی می داند. برنامه ریزی با توجه به ارزیابی های گذشته و شناسایی نیازمندی های عوامل خارجی (همچون سهامداران، مشتریان، خریداران و دیدگاه بلند مدت سازمان) برای عملکرد در دوره آتی، به عمل آید. با توجه به دو اصل توالی روند توسعه و بهبود فعالیتها و مهندسی مجدد، و با عنایت به ارزیابی عملکردهای گذشته فعالیت ها به اجرا گذاشته می شوند. ارزیابی نیز با توجه به معیارهای سنجش عملکرد در خصوص منابع سازمانی، نیازمندهای سهامداران، مشتریان و … صورت می گیرد

دانلود پایان نامه

به نظر بردرآپ، این تحلیل برای کلیه سطوح سازمانی کاربرد دارد. مرحله اول، در این مدت با برنامه ریزی و انجام فعالیت هایی چون تهیه و تدوین رسالت و استراتژی های سازمان و تعریف عملکرد آغاز می شود. در مرحله دوم، توسعه فرآیندهای جاری مدیریت و کیفیت بررسی می شود. در مرحله سوم، مقیاس های ارزیابی عملکرد تهیه، تدوین و بازنگری می شوند

شاخص های عملکرد

شاخص های مسیر حرکت سازمانها را برای رسیدن به اهداف مشخص می کند. نگاه اول در تدوین شاخص ها متوجه چشم انداز و مأموریت و اهداف کلان، راهبردهای بلند مدت و کوتاه مدت و برنامه های عملیاتی و به فعالیت های اصلی متمرکز می شود.هر شاخص عملکرد از یک عدد و یک واحد اندازه گیری تشکیل شده است، عدد میزان اهمیت (مقدار) و واحد معنای آن عدد را به ما نشان می دهد و همواره به یک هدف متصل اند. شاخص ها می توانند توسط واحدهای یک بعدی مثل ساعت، متر، نانو ثانیه، دلار، تعداد گزارشات و … نشان داده شوند.اکثر شاخص های عملکرد جزء یکی از شش گروه زیر قرار می گیرند:

1- اثر بخشی: میزان برآورد شدن نیازها توسط هر فرایند را نشان می دهد. (آیا ما کار درستی انجام می دهیم؟)

2- کارآیی: میزان استفاده از منابع توسط هر یک از فرآیندها برای رسیدن به اهداف نهایی را نشان می دهد. (آیا ما کارها را درست انجام می دهیم؟)

3- کیفیت: درجه تطابق کالا و یا خدمات با انتظارت و نیازهای مشتری.

4- زمان سنج: میزان درست انجام شدن و سر وقت بودن هر یک از عملیات را اندازه می گیرند. محدودیتی باید برای زمان انجام این فعالیت ها تعیین شود. این محدودیت ها بر مبنای نیاز مشتریان تعیین می شوند.

5- بهره وری: میزان ارزش افزوده بر فرایند بر مبنای تقسیم بندی ارزش نیروی کار و منابع مصرف شده.

Efficiency بهره وری

6- امنیت: میزان سلامتی سازمان و محیط کاری کارمندان را اندازه گیری می نماید. (رحیمی،1385،41 الی 44)

موضوعات: بدون موضوع  لینک ثابت
 [ 09:03:00 ق.ظ ]




- GPR30

در شروع دهه­ گذشته،یک گیرنده جفت­شده با پروتئین G متصل به غشا (GPR30) به عنوان یک پروتئین جدید متصل­شونده به استروژن شناسایی گردید(شکل1-8). GPR30 (GPER-1) دارای ساختاری است که کاملا متفاوت از ERهای کلاسیک است. این یک پروتئین غشایی اینتگرال و یک مولکول جفت­شده با پروتئینGکلاسیک است که در عناصر مختلف غشای سلولی (ازجمله غشای پلاسما و شبکه اندوپلاسمی) وجوددارد. GPR30 از طریق فعال­کردن آدنیلات سیکلاز موجب رها شدن مولکول­های متصل به غشای EGF می­ شود. فعالیتGPR30در سیستم­های مختلف از جمله اندام­های تولیدمثلی (PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،اندومتریوم،بیضه وتخمدان)، غده تیروئید،سیستم عصبی مرکزی و سیستم قلبی­عروقی گزارش شده­است(Nilsson et al.,2011).

مولکول­های گیرنده جدید

علاوه بر مولکول­هایی که در بالا به آن­ها اشاره شد،شواهدی وجوددارند که نشان می­ دهند سایر جایگاه­های غشایی برای اتصال استروژن وجوددارند. شواهد مبتنی هستند بر: (i) یافته­ های داروشناسی نشان می­ دهند که برخی تاثیرات سریع E2 توسط آنتاگونیست­های ER مهارنمی­شوند.درواقع، آنتاگونیست­هایER،آگونیست­هایGPR30یاERα36هستندFilardo&Thomas.,2012)).بهرحال،آن­ها هیچ تاثیری روی برخی حرکات یونی و آبشار های پیام­رسانی وابسته به E2 ندارند،حاکی از این­که واکنش­های دیگری با مولکول­های دیگر رخ می­ دهند. (ii) استفاده از آنالوگ­های نفوذناپذیر غشای پلاسماییE2 (E2یی که به صورت کووالانت به ماکرومولکول­های پروتئین مثل BSA یا به دندریمر های پلی­ساکاریدی وصل شده­است) Harrington et al.,2006)) تاثیرات سریعی را تحریک می­ کند و باعث القای تاثیرات رونویسی می­ شود که با آن­هایی که بهERα هسته­ای نسبت داده­می­شوند فرق دارند. (iii) درآخر، تعداد کمی از گزارشات هستند که به وجود یک پروتئین ناشناخته حکایت دارندکه از طریق affinity کروماتوگرافی و اتصال E2 در غشاهای سلول­های واکنش­دهنده با E2 شناسایی شده ­اند،که تا حدودی توسط آنتی­بادی­هایERα هم شناسایی می­شوند. متاسفانه،تا وقتی که این مولکول جدید به طور جامع شناسایی نگردد نمی­توان نتیجه­ قطعی گرفت. این یافته­ ها حاکی از آن هستند که احتمالا علاوه بر فرم­های گیرنده شناسایی­شده،مولکول­های دیگری هم هستند که می­توانند واسطه­ برخی تاثیرات E2 باشند،که ترجیحا در غشای پلاسمایی عمل میکنند. این حقیقت که درxenograftهای سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،مولکول­های دیگری که با آنتی­بادی­های ER واکنش می­ دهند شناسایی شده ­اند یافته فوق را تقویت می­ کند واین پیشنهادرا مطرح می کندکه درطول تکامل سرطان،ERها تنظیم پیچیده­تری دارندPiccart et al.,1998)).

1-16-پیام رسانی استروژن

1-16-1-پیام رسانی هسته­ای: نقش هم­تنظیم­کننده­ها و شاتل گیرنده

موقعیت اصلی ERها( ERα و ER β) درون هسته است. هرچند بعد از اتصال به لیگاند و در اثر نقشی که به عنوان یک تغییردهنده­ی رونویسی ایفامی­کنند،پراکنش هسته­ای تغییر می­ کند: در یک وضعیت بدون لیگاند،گیرنده به صورت یکنواخت درون ماتریکس هسته پراکندگی دارد ولی، بعد از واکنش با E2،ERها یک الگوی نقطه­نقطه می­گیرند،که خاص واکنش با عناصر هسته­ای ویژه است.به علاوه،شاتلینگ ثابت گیرنده بین سیتوپلاسم و هسته رخ می­دهد،درحالی­که اتصال آگونیست­ها و آنتاگونیست­ها موجب تغییر این فرایند دینامیک می­ شود. ورود ERها به هسته توسط اتصال آن­ها به پروتئین­های خاص، تسهیل انتقال آن­ها از طریق ترتیبی از آمینواسیدهای بازی (PKKKRK یا در مورد ERها، KRSKK) که پیام­های موقعیت هسته­ای[1] نام دارند تنظیم می­ شود.ERها حداقل سه تا از چنین توالی­ها  را دارند، که اتصال آن­ها به پروتئین­های حامل و ورود به هسته را تضمین می­ کند. درمقابل،ERها فاقد پیام خروج از هسته [2] که غنی از لوسین است هستند، ولی توالی­هایی دارند که همولوژی محدودی به آن­ها دارند.به علاوه، ERها می­توانند با پروتئین­های دیگری که حامل NESها هستند واکنش دهند، و به عنوان کمپلکس­های پروتئین-پروتئین به سیتپلاسم واردشوند. درنتیجه، موقعیت ERها در سلول یک فرایند پویا است که شامل چرخه­های پیوسته­ی شاتل هسته– سیتوپلاسم است. هم چنین، بعد از واکنش ER - DNA و یا فسفریلاسیون، مولکول­های گیرنده پلی­یوبی­کوئیتینه می­شوند،از DNA جدامی­گردند و موقتا در ماتریکس هسته انباشته می­شوند تا بعدا دراثر عملکرد پروتئازوم 26S تجزیه شوندKampa et al.,2013)).

درهسته،ERهایی که توسط لیگاند یا فسفریله­شدن فعال­شده ­اند، به توالی­هایDNA ویژه­ای که عناصر پاسخ استروژن نام دارند متصل می­شوند،تا رونویسی از ژن­های پاسخگو به استروژن تغییر کند،یا این که از طریق واکنش­های پروتئین– پروتئین با سایر فاکتورهای رونویسی واکنش می­ دهند تا ژن­های بدون EREها را تنظیم کنند. واکنش ER با پروتئین­های هم­تنظیم­کننده (هم­فعال­کننده­ها یا هم­مهارکننده­ها) موجب تقویت یا تضعیف این اتصال می­ شود. اتصال به هم­فعال­کننده و فعالیت برای منطقه­ی AF2ی ER بخوبی شنا خته شده­است. شایان ذکراست که این پروتئین­های هم­تنظیم­کننده دارای موتیف خاص LxxLL هستند و با تغییر شکل­فضایی به ERهای لیگانددار(یا فسفریله) متصل­شده و آن­ها را فعال می­ کنند. هم چنین یک پلاتفورم (P295-T311) بین منطقه لولا(D) و دومین اتصال به لیگاند (E/F) ERα که درمیان همه گیرنده های رده­ی NR3 حفاظت­شده­است فعالانه در اتصال به هم­تنظیم­کننده و تغییر فعالیت گیرنده نقش دارد. درمقابل،AF1، یک منطقه متصل­شونده به هم­تنظیم­کننده­ مستقل از لیگاند است که چندان مطالعه نشده­است. پیشنهادشده­است که دومین­های مختلف این منطقه ( آمینواسیدهای 1 تا 62، 80 تا 113، و 118 تا 149) پلاتفورم فعال این عملکرد را نشان می­ دهند، درحالی­که واکنش AF1 و AF2 می ­تواند رخ بدهد. در سال­های اخیر، تحقیقات وسیع با دیدگاه شناسایی، تغییر یا سنتز جدید پپتیدهای هم­تنظیم­کننده­ ER با یک الگوی درمانی،بخصوص در بروز مقاومت بیماران سرطانی (PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)) به درمان اندوکرینی انجام شده ­اند. این قبیل پپتیدها ها ” تعدیل­کننده­ های گیرنده استروژن پپتیدومیمتیک"[3] یا “مهارکننده­های اتصال هم­فعال­کننده"[4] نام دارندKampa et al.,2013)).

Nuclear  Localization Signals(NLS)1

Nuclear Export Signal(NES)2

Peptidomimetic Estrogen Receptor Modulators(PERM) 1

2Coactivator Binding Inhibitors(CBI)

 

موضوعات: بدون موضوع  لینک ثابت
 [ 09:02:00 ق.ظ ]




پیام رسانی خارج­ هسته­ ای

حتی دراولین مطالعات (اواسط دهه 50) روی عملکردهای استروئید،مشاهده شده­است که استروئیدها می­توانند گاهی­اوقات خیلی سریع عمل کنند، تاثیری که نمی­تواند به روش عملکرد ژنومیک زمان­بر و کلاسیک نسبت داده­شود. محققان افزایش حاد و زودهنگام (30ثانیه) cAMP ی رحم در رت­های تیمارشده با غلظت­های فیزیولوژیکی E2 را گزارش نمودند. این تحقیقات در طول سالهای دهه­های 70 و 80 ادامه یافت و چندین مقاله چاپ شدند که نشان می­دادند یک تاثیر استروئیدی سریع وجوددارد که در سطح غشای پلاسما شروع می­شودKampa et al.,2013)).

آدرس سایت برای متن کامل پایان نامه ها

پیام­رسانی گیرنده استروژن خارج­هسته­ای به کرات مطالعه شده­است. تاثیر آن­ها می ­تواند به شرح زیر گروهبندی شود:

01حرکت یونی از غشای پلاسمی

بعد از تعیین تاثیرات غشایی/خارج­هسته­ای استروژن، فعالیت مستقیم جریان یون کلسیم به سلول­ها گزارش شده­است.این تاثیر بعدها توسط گروه­های مختلف در تعدادی از لاین­های سلولی تایید شد و نشان می­داد که این تاثیر در عملکرد قلبی وابسته به E2 نقش دارد. به علاوه، یک تاثیر ویژه­ی E2 بروی کانال­های+ K درCNS و سایر بافت­ها ازجمله لوله­های کلیوی و معده مشخص شده­است. این تاثیر می ­تواند به تفاوت­های جنسیتی آب اپیتلیالی و حرکت یون در حالت سالم و حالت بیماری مربوط به آب و یون نسبت داده­شودKampa et al.,2013)).

2.کینازهای مربوط به غشا و واکنش با گیرنده های فاکتوررشد

فعالیت تعدادی از کینازها،که درپیام­رسانی غشایی نقش دارند یک مشاهده­ اولیه در مطالعه روی تاثیرات خارج­هسته­ای E2 بود. آن­ها عبارتند از آنزیم­ های تولیدکننده­ی نوکلئوتید حلقوی ,cAMP) cGMP) وپروتئین کینازهای فعال­شده،لیپیدکینازها (مثلPI3K)،Src کینازها و واکنش آن­ها (مستقیم مثلا برایGPR30یا غیرمستقیم از طریق Src) با گیرنده های فاکتور رشد. واکنشی که بیشتر از همه مطالعه­ شده­است واکنش با گیرنده فاکتور رشد اپیدرمی  است زیرا نقش برجسته­ای در زیست­شناسی سلول سرطان دارد و به عنوان یک هدف درمانی جایگاه ویژه­ای دارد. دراصل، یک جزء E2ی متصل­شونده به غشا ظاهرا به صورت فیزیکی یا ازطریق Srcکینازها با EGFR واکنش داده و آن را ترافعال می­ کند و به این ترتیب آبشارهای پیام­رسانی ویژه­ای القا می­شوند. جالب­تراین­که،در یک آنالیز ترانسکریپتوم کلی روی سلول­های سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) نشان داده شد که تیمار زودهنگام (3ساعته) سلول­ها با E2 ازطریق ERα باعث القای افزایش مستقیم رونویسی EGFR و گیرنده فاکتور رشد اپیدرمی انسانی3 [1] می­ شود، ولی mRNAی گیرنده فاکتور رشد اپیدرمی انسانی 4 [2] کاهش می­یابد و سطح گیرنده فاکتور رشد اپیدرمی انسانی2 [3] بدون تغییر می­ماند، که اولین مدرک برای تعدیل مستقیم EGFR توسط استروژن محسوب می­ شود( Kampa et al.,2013).

3.تغییر  آبشار های پیام­رسانی درون­سلولی

فعالیت کینازهای مربوط به غشا موجب تحریک یا تغییر تعدادی از آبشار های پیام­رسانی داخل سلولی می­ شود. استروژن­ها در تعدیل همه­ی آبشار های پیام­رسانی درون­سلولی مهم دخیل هستند Kampa) et al.,2013):

MAPکینازها،Jnk،cJUN،JAK-STAT،پیام­رسانیCamp،که به شروع رونویسیCREB  منجرمی­شود و درنهایت پیام­رسانی PI3K/Akt.این آبشار آخری می ­تواند منجر به رونویسی و یا تغییر اسکلت سلولی شود. درحقیقت،E2 تعدیل­کننده­ مهم اسکلت­سلولی اکتین در طیفی از سلول­ها است که باعث می­ شود روی رشدآکسون، دوباره­مدلگیری اندوتلیالی، یا مهاجرت سلولی تاثیر بگذارد( Kampa et al.,2013).

4.تاثیرات رونویسی

همانطورکه در بالا عنوان شد،پیامد نهایی مسیرهای پیام­رسانی که با استروژن تحریک می­شوند فعالیت تعدادی از فاکتورهای رونویسی هسته­ای است.جالب­تراین­که،پیام رسان رونویسی تمایزی استروژن عمل­کننده­ غشایی (E2-BSA) یا استروژن نفوذ پذیر(E2) منجر به تغییر ژن­های مختلفی می­ شود. پیام های کلاسیک وابسته به ER منجر به فعالیت ژن­ها و فاکتورهای رونویسی می­شوند که تکثیرسلول،مهاجرت سلولی را تنظیم کرده و آپوپتوز را مهارمی­کنند.درمقابل،پیام­های وابسته به36ERαعملکردهای ایمنی را تعدیل می­ کنند، ولی پیام هایی که در غشا شروع می­شوند منجر به تغییر اکتین، تغییر آبشارهای پیام­رسانی درون­سلولی وتنظیم منفی عملکردهای ایمنی می­گردند. از این نظر، تفاوت روشن بین تاثیرات رونویسی آغازی ژنومی و غیرژنومی استروژن  برای اولین بار شرح داده­شدندKampa et al.,2013)).

Human Epidermal Growth Factor Receptor 3(HER3)1

Human Epidermal Growth Factor Receptor 4(HER4)2

Human Epidermal Growth Factor Receptor 2(HER2)3

موضوعات: بدون موضوع  لینک ثابت
 [ 09:00:00 ق.ظ ]




روش های تشخیص آزمایشگاهی

1-روش ایمونوهیستوشیمی [1]             2- روش های مولکولی

1-17-1-روش ایمونوهیستوشیمی

ایمونوهیستوشیمی یا بافت‌شیمی ایمنی، نام یک فرایند برای مکان‌یابی پروتئین‌ها در یاخته‌های یک بافت است.اساس این روش، قرار دادن برش‎های بافتی تحت تأثیر آنتی بادی‎های خاص برای تشخیص یک سری پروتئین خاص می‎باشد. پروتئین‎های مورد نظر از طریق اتصال آنتی بادی‎ها به یک سوبسترای رنگی، شناسایی و حتی تعیین مقدار می‎شوند(قادریان و همکاران.،1389).

دانلود پایان نامه

ایمونوهسیتو شیمی به دو روش انجام می‎گردد:

الف) رنگ آمیزی بافت‎های آغشته به پارافین

ب) رنگ آمیزی بافت‎های منجمد شده

ایمونوهیستوشیمی در حاضر به عنوان یکی از روش‌های تشخیصی در شاخه پزشکی و به‌ویژه دانش آسیب‌شناسی  محسوب می شود(قادریان و همکاران.،1389)

روش های مولکولی

روش های تکثیر  اسید نوکلئیک در شرایط آزمایشگاه را می توان در سه گروه اصلی طبقه بندی نمود:

1- روش های تکثیر کاوشگر یا پروب[2]

2-روش های تکثیر پیام[3]

3-روش های تکثیر هدف[4]Tang et al.,1997)).

1-17-2-1-سیستم های تکثیر هدف

در این گروه تکنیک های مهمی همچون واکنش زنجیره ای پلیمراز[5]و انواع آن مانند سیستم تکثیر بر اساس نسخه برداری[6] ،نسخه های پیشرفته TAS به نام همانندسازی سکانس خود نگهدارنده[7] و تکثیر بر اساس رشته جابه جا سازی شونده[8] هم چنین تکنیک هایی مثل RT-PCR وPCR RealTime وجود دارد.در سیستم های تکثیر اسیدنوکلئیک در شرایط آزمایشگاه،مولکول هدف(DNA یا RNA) به طور آنزیماتیک به تعداد زیادی همانند سازی می گردد تا میزانی که بتوان محصول را با روش هایی مثل الکتروفورز در ژل آشکار نمود(شاه حسینی.،1384).

1-17-2-1-الف-RT-PCR

RT-PCR (شکل1-10) یک روش حساس،سریع و قابل اعتماد جهت تجزیه و تحلیل بیان ژن ها است که تا حدی اطلاعات نیمه کمی جهت میزان بیان ژن به وجود می آوردWojdacz et al.,2008)). از دید تئوری درRT-PCR می توان حتی یک مولکول هدف RNA را هم مورد بررسی قرار داد هرچند در عمل مانند هر تکنیک دیگری،حساسیت به دلایل متفاوت ممکن است کاهش یابد.RT-PCR  یک ابزار به غایت ارزشمند جهت بررسی بیان ژن می باشد. در این زمینه می توان از استراتژی های مختلف زیر استفاده نمود(شاه حسینی.،1384):

1-استفاده از پرایمر های ویژه هدف

2-oligo-dt جهت درست کردن کتابخانه cDNA

3-هگزامر تصادفی

4-پرایمر های ویژه 5-cap(شاه حسینی.،1384).

Immunohistochemistry1

Probe Amplification Methods1

Signal Amplification Methods2

Target Amplification Methods3

Polymerase Chain Reaetion(PCR)4

Transcription based Amplification(TAS)5

Self-sustained sequence replication(3SR) 6

Strand Displacement Amplification (SDA) 7

 

موضوعات: بدون موضوع  لینک ثابت
 [ 08:59:00 ق.ظ ]




تفاوت سند با سایر ادله‌ی اثبات دعوا

بدون شک ادله‌ی اثبات دعوی از نظر قدرت اثباتی در یک درجه نیستند و همانطور که در قانون سند را بعد از اقرار، دومین دلیل ذکر کرده است، آوردن سند در این ترتیب، نشانه‌ی قدرتی است که سند در بین سایر ادله دارد. سند وسیله‌ای است که چون مکتوب است و مورد تأیید از طرف مأمور دولت می‌باشد، دارای قدرت اثباتی بالایی است.

متداولترین وسیله برای اثبات حق، سند است. تشریفات طولانی دادرسی و هزینه‌های آن باعث شده است که اشخاص در این راه دشوار چاره اندیشی کنند؛ با طرف خود به گفتگو پردازند و راه گریزی بیابند. دعوی هنگامی‌که امید هرگونه اصلاح از بین رفته باشد آغاز می‌شود و هر دو طرف در مطالبه و انکار حق مصممند. در این شرایط به ندرت اتفاق می‌افتد که خوانده به سود طرف خود اقرار کند و دادرس را از استناد به سایر دلایل بی‌نیاز نماید. شهادت و سوگند در قراردادها بیشتر برای تقویت و تکمیل اسناد بکار می‌روند و به ندرت مورد استفاده قرار می‌گیرند. امارات نیز در همه دعاوی قابل استناد نیست. اماره بر مبنای غلبه و ظاهر استوار است و دادگاه به طور مستقیم بوسیله‌ی آن به حقیقت نمی‌رسد. از آنجا که سند قبل از دعوی تنظیم می‌شود و هنوز نزاعی در بین نیست، دو طرف با حسن نیت و دقت بیشتر آن را می‌نویسند و گاه نیز سردفتر یا مشاور حقوقی، آنان را راهنمایی می‌کند. این نوشته ثابت می‌ماند و گذشت زمان از اعتبار آن نمی‌کاهد، در حالی که خاطره‌ها از بین می‌رود و ممکن است گواهان از دسترس مدعی خارج شوند. از همه مهمتر اینکه، ارزیابی سند با دادگاه نیست و ضرورتی ندارد که مانند شهادت دادرس را قانع کند. «دادگاه نمی‌تواند به مفاد اسنادی که صدور آن از کسی که سند به او نسبت داده شده محرز باشد بدون دلیل ترتیب اثر ندهد».(ماه ۳۷۵ ق.آ.د.م).[1]

دیگر اینکه سند حاوی دلیل است و خودش دلیل نمی‌باشد. اکثر اسنادی که ارائه می‌شود حاوی اقرار است؛ مانند سندی که حاوی ثبت اقرار بدهی کسی می‌باشد. پس سند یک دلیل تأمینی است، یعنی برای صورت‌برداری از دلایل توسط دادگاه جهت ارائه‌ احتمالی بعدی به مراجع قضایی می‌باشد. ادله‌ی تأمینی، وسایلی هستند که به ثبت دلایل می‌پردازند، یعنی دلیل بر دلیل هستند. بنابراین سند زیر مجموعه‌ی ادله‌ی اصلی قرار نمی‌گیرد و فقط برای نگهداری و ثبت دلیل می‌باشد.[2]

بخش دوم- تعارض سند با سایر ادله‌ی‌ اثبات دعوا

مبحث اول- مفهوم تعارض ادله‌ی اثبات دعوا

گاهی ممکن است در محاکم قضایی که سندی به عنوان دلیل مورد استناد قرار گرفته است، طرف مقابل، دلیل دیگری از ادله‌ی اثبات دعوی و یا حتی سند دیگری (رسمی یا عادی) را ارائه نماید که در مقابل سند ارائه‌شده بایستد و با آن مقابله کند. در این صورت میان سند و ادله‌ی دیگر تعارضی پیش می‌آید که دادگاه باید یکی از این ادله را طبق مقررات و قدرت اثباتی آن دلایل، ترجیح داده و بر اساس آن حکم نماید.

«تعارض ادله‌ی اثبات دعوا[3] عبارت است از تقابل و تضاد استنادی دو طرف دعوی، به نحوی که عمل به هر دو دلیل و جمع آنها ممکن نباشد».[4]

مبحث دوم- شرایط تحقق تعارض

قبل از بررسی تعارض اسناد با سایر ادله لازم به ذکر است که بدانیم برای تحقق تعارض بین ادله چه شرایطی وجود دارد.

برای آنکه بین ادله‌ی اثبات دعوی تعارض حاصل شود، وجود شرایطی لازم می کند که می‌توان آنها را در چهار عنوان ذیل خلاصه نمود:

الف- وجود حداقل دو دلیل. وجود دو دلیل، بیانگر حداقل ادله‌ی لازم برای تحقق تعارض بوده، ولی ممکن است چند دلیل با هم تعارض نمایند.[5]

ب- تنافی و تکذیب یکدیگر. به طوری که هر دلیل جزئاً یا کلاً دلیل دیگر را تکذیب کند و اجتماع آنها با یکدیگر ممکن نباشد.[6]

[1]- کاتوزیان، ناصر، مقدمه علم حقوق، شرکت سهامی انتشار، تهران، چاپ سی و هشتم، ۱۳۸۳، ش ۳۴۲.

[2]- طبق ماده ۱۴۹ ق.آ.د.م «در مواردی که اشخاص ذینفع احتمال دهند که در آینده استفاده از دلایل و مدارک دعوای آنان از قبیل تحقیق محلی و کسب اطلاع از مطلعین و استعلام نظر کارشناسان یا دفاتر تجاری یا استفاده از قرائن و امارات موجود در محل و یا دلایلی که نزد طرف دعوی یا دیگری است، متعذر یا متعسر خواهد شد، می‌توانند از دادگاه درخواست تأمین آنها را بنمایند. مقصود از تأمین در این موارد فقط ملاحظه و صورت‌برداری از اینگونه دلایل است».

[3]- Contradiction (conflict) of evidence

[4] - عمروانی، رحمان، تعارض ادله‌ی اثبات دعوی، انتشارات فکرسازان، تهران، چاپ اول، ۱۳۹۰، ص ۳۰.

[5]- محقق داماد، سید مصطفی، مباحثی از اصول فقه، مرکز نشر علوم اسلامی، تهران، چاپ سوم، زمستان ۱۳۸۳، جلد سوم، ص ۱۲۵. محمدی، ابوالحسن، مبانی استنباط حقوق اسلامی، انتشارات دانشگاه تهران، چاپ بیست و هفتم ۱۳۸۵، ص ۳۴۵.

[6]- «یتحقق التعارض فی الشهادت مع تحقق التضاد، …». (تعارض در شهادت در صورت تضاد محقق می‌شود، …) محقق حلی، شرایع الاسلام، مجلد ثانی، فی اختلاف فی الدعوی از کتاب قضا، انتشارات استقلال، تهران، چاپ سوم، ۱۳۷۰ شمسی، ص ۸۹۷. که در سند نیز همین صادق است.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:57:00 ق.ظ ]




تفصیل تعارض سند با سایر ادله‌

در این مبحث به بررسی نحوه‌ی تعارض سند با سایر ادله و تکلیف تعارض میان آنها به صورت جداگانه می‌پردازیم.

گفتار اول- تعارض سند با شهادت

مطابق با ماده ۱۳۰۹ ق.م، در مقابل سند رسمی یا سندی که اعتبار آن در محکمه احراز گردیده است نمی‏توان به استناد شهادت شهود، دعوایی را اقامه و اثبات کرد که با مفاد یا مندرجات آن مخالف باشد. همچنین ماده ۱۳۲۴ از همان قانون اعلام می‏دارد: «اماراتی که به نظر قاضی واگذار شده عبارت است از اوضاع و احوالی در خصوص مورد، و در صورتی قابل استناد است که دعوی به شهادت شهود قابل اثبات باشد یا ادله دیگر را تکمیل کنند». نتیجه‏ای که ممکن است از جمع میان این دو ماده به دست آید این است که دعوای مخالف با مفاد یا مندرجات سند رسمی، با شهادت شهود یا اماره قابل اثبات نمی‏باشد، هر چند شهادت دارای شرایطی که در شرع معین شده نیز باشد. فقهای شورای نگهبان در نظریه شماره ۲۶۵۵-۱۸/۸/۶۷ چنین اظهار نظر کردند: «شورای عالی محترم قضایی، پیرو سؤالی که در مورد مشروعیت ماده ۱۳۰۹ قانون مدنی از شورای نگهبان شده بود، موضوع در جلسه شورای نگهبان مطرح و مورد بحث و بررسی قرار گرفت. نظر فقهای شورای نگهبان با بهره گرفتن از اصل ۴ قانون اساسی به شرح ذیل اعلام می‏گردد:

ماده ۱۳۰۹ قانون مدنی، از این نظر که شهادت بینه شرعیه را در برابر اسناد معتبر فاقد ارزش دانسته، خلاف موازین شرع (بوده) و بدین وسیله ابطال می‏گردد.

به موجب این نظریه باید گفت که دعوای مخالف با مفاد یا مندرجات سند رسمی، اگر با کمک شهودی اقامه شود که شرایط بینه شرعیه باشند قابل اثبات نیست.[1] اما از سوی دیگر، بر طبق این نظر و نیز ماده ۱۳۲۴ ق.م، می‏توان گفت که چنان ادعایی با امارات قابل اثبات می‏باشد زیرا دعوای مخالف را می‏توان به شهادتی که دارای شرایط بینه شرعیه است اثبات نمود.

برخی از حقوقدانان بدون آنکه به محتوای این بحث اشاره‏ای داشته باشند در متن کتاب خود، ماده ۱۳۰۹ را مورد توجه قرار داده و بخشی از مباحث حقوقی خود را بر پایه مفاد آن طرح کرده‏اند، اما در حاشیه کتاب هم به نسخ ماده مزبور تصریح کرده‏اند.[2] در حالی که نسخ ماده حاکی از عدم جواز استناد به آن می‏باشد. در هر صورت، اگر نویسنده‏ای نظر مخالفی داشته باشد بهتر است که آن را به همراه استدلال‌های مربوط به آن بیان کند. برخی دیگر تنها به ذکر ماده، ادله تأیید کننده مفاد آن، و نقل نظر شورای نگهبان اکتفا کرده و موضع صریحی را اتخاذ نکرده‏اند؛[3] و در واقع، شاید با این نوع بیان، نیم نگاهی به نظر مخالف داشته‏اند.

یکی دیگر از حقوقدانان اظهارنظر کرده است که اعلام این نظریه توسط شورای نگهبان، به این صورت مجمل و کلی، صحیح نیست زیرا بینه شرعی اخص از شهادت است و ماده ۱۳۰۹ ق.م، شهادت را به طور مطلق فاقد صلاحیت برای دعوای مخالف با مفاد و مندرجات سند رسمی یا معتبر در دادگاه دانسته است و به طور خاص به بینه شرعی نپرداخته است؛ لذا بهتر بود شورا نظریه خود مبنی بر عدم صحت و وجود مغایرت مفاد ماده مذکور با موازین شرع را، تنها درباره «اطلاق» این ماده صادر می‏کرد. بدین ترتیب اگر شهادت، شرایط بینه شرعی را داشته باشد معتبر محسوب می‏گردد.[4]

این نظریه که اشکال را در اطلاق ماده مزبور می‏داند از این جهت دارای اشکال به نظر می‏رسد که بینه شرعی مفهومی مقید و خاص نسبت به شهادت نیست بلکه نوع و مصداقی از شهادت می‏باشد که در شرع اعتبار دارد و با فرض شهادت‌های معتبر دیگر، می‏توان برای شهادت، چند نوع را تصور کرد، همچنان که شهادت یک نفر عادل یا مورد اطمینان، به صدور حدیثی خاص از یکی از معصومان (ع) و یا حکایت آن توسط فرد مذکور، در نزد شرع از اعتبار برخوردار است. بنابراین، به نظر می‏رسد که آنچه توسط شورای نگهبان انجام شده، در واقع تخصیص ماده بوده است نه تقیید آن؛ و بهتر آن است که گفته شود که نظریه شورا تنها تا حد تخصیص نسبت به ماده ۱۳۰۹ اعمال می‏گردد و این‏گونه نیست که آن را از اساس بی‏اعتبار سازد.

در نظر دیگری که ابراز شده گرچه به نظریه شورای نگهبان اشاره نشده است اما به شیوه تفسیر قانون، سعی بر آن داشته تا از عمومیت مفاد ماده مورد بحث کاسته و اعتبار شهادت را در برخی موارد ثابت نماید. در حقوق ما هنوز این مسئله به طور کامل مطرح نشده است که این ماده (۱۳۰۹ ق.م) تا چه اندازه از اعتبار شهادت در اثبات اشتباه می‏کاهد، ولی به نظر می‏رسد که مفاد سند، دلالت بر منطبق بودن آنچه اعلام شده با اراده باطنی ندارد. پس بدون برخورد با مانع ماده ۱۳۰۹، مدعی می‏تواند با شهادت یا اماره ثابت کند که در اعلام اراده، اشتباه رخ داده است. به طریق اولی، در جایی هم که ادعا ناظر به نادرستی تصور مبنای اراده واقعی است ماده ۱۳۰۹ مانعی به وجود نمی‏آورد و این پدیده روانی را به همه دلایل می‏توان ثابت کرد. اشکال واقعی در فرضی است که ادعا می‏شود نویسنده سند به اشتباه یا به عمد آنچه را به او اعلام شده ننوشته یا مشتبه، بدون توجه سند را امضا کرده است. در این فرض، مدعی می‏خواهد ثابت کند که مفاد توافق با آنچه در سند نوشته و امضا شده است تفاوت دارد و پذیرفتن این ادعا، با مفاد سند مخالف است… مگر اینکه اشتباه مادی و بدیهی باشد و به استناد شهادت بتوان آن را تصحیح کرد (ملاک ماده ۱۸۹ ق.آ.د.م[5]).[6]

در این نظر میان ادعاهای مغایر با سند که مستند آنها عمل منتسب به دیگری است با ادعاهایی که ناشی از عملکرد منتسب به خود مدعی است تفاوت گذارده شده است و اثبات «عدم انطباق اعلامیات مدعی با اراده باطنی او» یا «مبتنی بودن اعلامیات او بر تصورات غلط» توسط شهادت را صحیح و منطبق با مفهوم قانون و ماده قانونی مذکور می‏داند اما اگر دو ادعای پیشین را اقامه نکرده بلکه تنها نسبت به صحت و انطباق نوشته‏های سند با اعلامیات خود اعتراض دارد در این صورت اگر اشتباه، مادی و بدیهی فرض نشود آن را به وسیله شهادت قابل اثبات نمی‏داند.

[1]- غلامرضا شهری، همان، ص ۲۵۹-۲۵۸.

[2]- صدرزاده، افشار، ادله‌ی اثبات دعوی در حقوق ایران، مرکز نشر دانشگاهی، تهران، چاپ اول، 1369، پاورقی ص ۵۸.

[3]- عظیمی، محمد، ادله اثبات دعوی، انتشارات هاد، تهران، چاپ اول، 1369، ص ۱۴۷-۱۴۶، و پاورقی ص ۱۷۹.

[4]- تقریرات غلامرضا شهری در کلاس درس با عنوان حقوق ثبت.

[5]- ماده ۱۸۹ ق.آ.د.م مصوب ۱۳۱۸: «هر گاه در تنظیم حکم یا قرار دادگاه، اشتباه در حساب یا سهو قلم یا سایر اشتباهات بینی رخ دهد مثل از قلم افتادن یکی از اصحاب دعوی یا زیاد شدن نام، دادگاه صادرکننده می‏تواند مادام که قرار یا حکم اجرا نشده است به درخواست اصحاب دعوی حکم یا قرار را تصحیح کند…».در ماده ۳۰۹ ق.آ.د.م‏ مصوب ۱۳۷۹، نیز آمده است: «هر گاه در تنظیم و نوشتن رأی دادگاه، سهو قلم رخ دهد، مثل از قلم افتادن کلمه‏ای یا زیاد شدن آن و یا اشتباهی در محاسبه صورت گرفته باشد تا وقتی که نسبت به آن درخواست تجدیدنظر نشده، دادگاه رأساً یا به درخواست ذینفع، رأی را تصحیح می‏نماید…».

[6]- کاتوزیان، ناصر، حقوق مدنی، قواعد عمومی قراردادها، بهنشر، تهران، چاپ اول، ۱۳۶۴، جلد ۱، مبحث اثبات اشتباه.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:56:00 ق.ظ ]




در این نظر میان ادعاهای مغایر با سند که مستند آنها عمل منتسب به دیگری است با ادعاهایی که ناشی از عملکرد منتسب به خود مدعی است تفاوت گذارده شده است و اثبات «عدم انطباق اعلامیات مدعی با اراده باطنی او» یا «مبتنی بودن اعلامیات او بر تصورات غلط» توسط شهادت را صحیح و منطبق با مفهوم قانون و ماده قانونی مذکور می‏داند اما اگر دو ادعای پیشین را اقامه نکرده بلکه تنها نسبت به صحت و انطباق نوشته‏های سند با اعلامیات خود اعتراض دارد در این صورت اگر اشتباه، مادی و بدیهی فرض نشود آن را به وسیله شهادت قابل اثبات نمی‏داند.

درباره، مقصود از «مفاد» و «مندرجات» سند که در ماده ۱۳۰۹ آمده، باید گفت که مفاد، امری معنوی است که از عبارات-برای مثال- استنباط می‏شود و به نظر می‏رسد که قصد قانونگذار این بوده که حجیت عبارات متن و دیگر مندرجات سند را درباره مفاد آنها تثبیت کند. بدین ترتیب، مقنن خواسته است به شیوه‏ای عقلانی اتکا کند و با فرض رسمی بودن یا احراز اعتبار سند در دادگاه، اصل را بر اعتبار مفاد و مندرجات آن قرار دهد تا آنکه کسی با اینگونه استدلال‌ها که اراده باطنی‌اش به چیزی غیر از مفاد سند تعلق گرفته بوده و یا تصورات ذهنی نادرست او موجب اعلام اراده‏اش به آنگونه که در سند موجود است گردیده است، نتواند اعتبار چنان سندی را مخدوش سازد. پس قانونگذار مفاد اجزای سند را نیز مطابق با اراده باطنی و مبتنی بر یک تصور صحیح قلمداد کرده و به دلیل اعتبار رسمی آن، ادعای مخالف با آن را که مستند به شهادت باشد غیرقابل قبول اعلام داشته است و به همین جهت، کلمه «مفاد» را در کنار «مندرجات» ذکر نموده است. همچنین، این نوع تحلیل درباره روش مقنن، با اصول و قواعد عرفی، همچون اصل عدم اشتباه ذهنی (در تصور موضوع) و اصل عدم غفلت و اصل عدم اشتباه لفظی سازگاری دارد. بنابراین تحلیل نظریه اخیر درباره قصد قانونگذار نسبت به مفاد سند در ماده مورد بحث، موجه به نظر نمی‏رسد.

بعلاوه درباره قسمت اخیر این نظریه، یعنی امکان اثبات اشتباه مادی و بدیهی در ثبت اعلامیات، توسط شهادت، جای تأمل و بحث و نقد وجود دارد. زیرا اگر مقصود نویسنده این است که اشتباه مذکور، تا حدی بدیهی باشد که طرف مقابل هم آن را پذیرفته و اصلاح می‏کند چنین فرضی از قلمرو مسئله مورد بحث در ماده ۱۳۰۹، که اثبات ادعایی است که مورد انکار طرف مقابل می‏باشد، خارج است و اصولاً چه بسا نیازی به اقامه دعوی در دادگاه نداشته و به استناد ملاک همان ماده ۱۸۹ ق.آ.د.م که نویسنده به آن استناد جسته، می‏توان راحتی آن را اصلاح کرد؛ و اگر مقصود ایشان این است که آن اشتباه، تنها از سوی یک طرف بدیهی بنماید، علاوه بر آنکه اثبات بدیهی بودن خود امری اضافه بر اصل مدعا می‏شود، ادعای امکان اثبات آن با شهادت «مصادره به مطلوب» است و با وجود تصریح ماده ۱۳۰۹ به معتبر بودن سند از نظر مفاد و مندرجات، باید چنین امکانی اثبات گردد و ملاک ماده ۱۸۹ ق.آ.د.م به هیچ وجه چنین چیزی را تأیید نمی‏کند زیرا در این ماده به تصحیح اشتباهی پرداخته شد که بیّن بودن اشتباه برای طرف ادعای اشتباه، یعنی دادرس دادگاه، مفروض قلمداد گردیده و مدعی علیه این ادعا، یعنی خود دادرس، آن را قبول دارد. بعلاوه آنکه دادرس در حکم دعوای اصلی که مورد تصحیح قرار می‏گیرد ذینفع نبوده و این حالت با صورت مسئله ما متفاوت است.

همچنین بخش دیگری از نظریه مذکور، دائر بر اینکه «ادعا می‏شود نویسنده سند… به عمد آنچه را به او اعلام شده ننوشته» به نظر می‏رسد که می‏تواند از مصادیق جعل باشد که با این بحث ارتباطی ندارد.

بدین بیان، تحلیل نظریه اخیر، اگر با صرف‌نظر از نظریه شورای نگهبان مطرح گردیده باشد راهگشا نبوده و به صرف استناد به مواد ۱۳۰۹ ق.م و ۱۸۹ ق.آ.د.م، انکار مفاد یا مندرجات سند رسمی و ادعای مغایر با آنها به وسیله شهادت قابل اثبات نمی‏باشد و تفسیر مذکور از شمول ماده ۱۳۰۹ نمی‏کاهد. در نتیجه، تعارض میان این ماده و نظریه فقهای شورای نگهبان در تمام موارد باقی می‏ماند.

در اینجا باید به دو نکته اشاره شود:

نخست اینکه آنچه در متن نظریه شورای نگهبان آمده، عبارت از «ابطال» ماده مورد بحث است در حالی که در ضمن بحث، ملاحظه شد که آنچه بیشتر به اذهان متبادر می‏شود نسخ ماده ۱۳۰۹ است. جدای از اینکه آیا شورای نگهبان دارای اختیار و صلاحیت نسخ یا ابطال قوانین هست یا نه، به نظر می‏رسد آنچه مورد نظر شورا بوده نسخ ماده بوده است و این امر با قاعده عطف به ماسبق نشدن قوانین نیز هماهنگی دارد، در حالی که در صورت باطل دانستن ماده مذکور اثر قهقرایی داشته و دعاوی جدیدی را در دادگاه‏ها مطرح می‏سازد.

نکته دوم این است که بحث جاری بر این فرض استوار است که سند از حجیت مستقل برخوردار می‏باشد؛ در غیر این صورت، سند تنها به عنوان اماره‏ای برای قاضی مطرح می‏باشد و در صورت حصول علم و قطع برای قاضی از آن سند، بر طبق مفاد آن رأی خود را صادر می‏نماید. نتیجه این تحلیل آن است که با پذیرش نظریه دوم باید درباره سند، صورت مسئله از تعارض میان سند و شهادت، به تعارض میان علم قاضی و شهادت تغییر خواهد یافت و در واقع، چون سند به طور مستقل دارای اعتبار نخواهد بود لذا تعارضی میان آن و شهادت به وجود نخواهد آمد و با اقامه شهادت، همراه با شرایط اعتبار آن، بر طبق مشهود به حکم صادر می‌گردد و ناگفته پیداست که مجرای ماده ۱۳۰۹ در جایی است که سند و شهادت، به طور مستقل و با دارا بودن شرایط اعتبار خود، هر یک به تنهایی بتوانند- به فرض عدم تعارض - مدعا را اثبات کنند. پس از مفروض دانستن این مقدمه است که می‏توان صحبت از تعارض میان آن دو و اعمال ماده ۱۳۰۹ ق.م به میان آورد. در غیر این صورت، اصلاً تعارضی محقق نمی‏گردد و وفق مفاد هر دلیلی که ابراز شده باشد حکم صادر می‏گردد و نوبت به ماده ۱۳۰۹ نمی‏رسد. بنابراین، اگر اشکال شود که با وجود شهادت‌های ناصحیح، چگونه به تعارض آن با سند و حتی برتری شهادت حکم می‏کنید، در پاسخ گفته می‏شود که مقصود از شهادت در این بحث، شهادت معتبری است که واجد شرایط اعتبار، از جمله شهادت از روی حس یا شهادت از روی حدس باشد. در واقع، اینجا مهارت و دقت نظر دادرس است که اعتبار ادله ابرازی را ارزیابی می‏کند.[1]

[1]- صفری، محسن، تعارض میان سند و شهادت در حقوق مدنی ایران و فقه امامیه، مقاله، مجله دانشکده حقوق و علوم سیاسی (دانشگاه تهران)، تابستان ۱۳۸۱، شماره ۵۶.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:54:00 ق.ظ ]




تعداد طلاق

درفقه امامی زوجه پس از سه بار طلاق عدی بر شوهر حرام موقت می‌شود. در  این مثال زوج زمانی می‌تواند با زوجه نکاح واقع نماید که زوجه با نحلل ازدواج نماید. و نیز پس از نه بار طلاق عدی (پس از هر سه طلاق یک محلل وجود دارد) بر زوج حرام موبد می‌شود. در این موضوع اختلافی نیست. دکتر محقق در این باره به تفصیل می‌گوید:

دانلود تحقیق و پایان نامه

«… بر موضوع فوق اجماع فقهاى امامیّه محقّق است و نصوص بسیار زیادى از سوى معصومین (ع) در خصوص آن وارد گردیده؛ ولى باید توجّه داشت که متن محل اجماع فقها چنین است «المطلقه تسعا للعده …» یعنى: «طلاق داده شده با 9 طلاق عدّى. درحالى‌که ترتیبى که بیان شد از میان 9 طلاق انجام شده فقط 6 تاى آن عدّى است، زیرا طلاق سوّم در هر بار که موجب تحریم شده عدى نیست بلکه بائن است، چرا که گفتیم طلاق عدّى آن است که در عدّه رجوع و دخول صورت گیرد و طلاق سوّم اینچنین نیست.

امّا با مراجعه به نصوص وارده  در مسأله مشخّص مى‌گردد که منظور فقهاء به همان صورتى است که ذکر شد یعنى در حقیقت بر نه طلاقى که تنها شش‌تاى آن عدّى است، 9 طلاق عدّى اطلاق نموده‌اند که مى‌گویند مجاز با علاقه مجاورت و یا اکثریت و یا کل و جزء است. با این تحلیل که طلاق سوّم چون در مجاورت دو طلاق عدّى قرار گرفته هر چند که عدّى نیست، عدّى گفته شده است و یا آنکه به علّت اکثریّت عدّى بر غیر عدّى. با امعان نظر در نصوص وارده و متون فقها مستفاد مى‌گردد که براى تحقّق حرمت ابدى شرائط زیر لازم است و با فقدان هر یک از شرائط، حرمت مترتّب نخواهد شد:

الف) بایستى در تمامى طلاقهاى سه‌گانه، که مستلزم محلّل شده است، دو رجوع در میان فاصله شده باشد. و چنانچه مثلا طلاق صورت گیرد و پس از انقضاى عدّه با عقد مجددا زوجیّت تشکیل یافته باشد، هر چند بار سوّم موجب محلّل گردیده (زیرا لزوم محلّل متوقف بر آن نیست که طلاقها عدّى باشد و زوج در عدّه رجوع نماید) ولى در عین حال این اثر را دارد که در بار نهم موجب حرمت ابدى نخواهد بود. حتّى به تعبیر بعضى از فقهاء اگر صد بار هم چنین می‌شد حرمت ابدى ببار نخواهد آورد.

ب) بایستى پس از رجوع در عدّه دخول صورت گرفته باشد، و چنانچه در عدّه رجوع نموده ولى بدون دخول مبادرت به طلاق نماید، هر چند بار سوّم موجب حرمت و براى حلال شدن محتاج به محلّل است، ولى در عین حال براى بار نهم حرمت ابدى ترتّب نخواهد یافت.

دو شرط فوق در کلمه طلاق عدّى نهفته است. یعنى وقتى گفتیم از نه طلاق انجام شده بایستى شش‌تاى آن عدّى باشد، لزوم شرائط فوق احساس مى‌گردد. زیرا چنانچه زوج در طلاقهاى اوّل، دوّم، چهارم، پنجم، هفتم و هشتم و در مدّت عدّه رجوع نکند، و یا رجوع کند ولى آمیزش ننماید، طلاق انجام شده عدّى نخواهد بود؛ و بنابراین نهمین طلاق محرم ابدى نمى‌باشد».[1]

ماده1057 قانون مدنی می‌گوید: زنی که سه مرتبه متوالی زوجه یکنفر بوده و مطلقه شده بر آن مرد حرام میشود مگر اینکه بعقد دائم بزوجیت مرد دیگری در آمده و پس از وقوع نزدیکی با او بواسطه طلاق یا فسخ یا فوت فراق حاصل شده باشد.

ماده 105۸ قانون مدنی می‌گوید: «زن هر شخصی که به نه طلاق که شش تای آن عددی است مطلقه شده باشد بر آن شخص حرام موبد می‌شود».

ولی سایر مذاهب اهل سنت من جمله مذهب حنفی، قائل به حرمت ابدی پس تعداد معینی طلاق نیستند. آقای مغنیه در این باره می‌گوید:

«اتفقوا على ان الرجل إذا طلق زوجته ثلاثا بینهما رجعتان حرمت علیه، و لا تحل له حتى تنکح زوجا غیره، و ذلک ان تعتد بعد الطلاق الثالث و عند انتهاء العده تتزوج زواجا شرعیا دائما، و یدخل بها الزوج، فإذا فارقها الثانی بموت أو طلاق و انتهت عدتها جاز للأول ان یعقد علیها ثانیه، فإذا عاد و طلقها ثلاثا حرمت علیه حتى تنکح زوجا غیره، و هکذا تحرم علیه بعد کل طلاق ثالث، و تحل له بمحلل، و ان طلقت مائه مره، و على هذا یکون الطلاق ثلاثا من أسباب التحریم المؤقت لا المؤبد».[2]

[1] محقق داماد، مصطفى، بررسى فقهى حقوق خانواده - نکاح و انحلال آن، ص۱۴۵.

[2] مغنیه، محمد جواد، الفقه على المذاهب الخمسه، ج۲، ص۳۱۳.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:53:00 ق.ظ ]




حرمت رضاعی

در این گفتار به بررسی اختلافات امامیه و حنفیه در مبحث شرایط ایجاد حرمت رضایی پداخته می‌شود.

دانلود پایان نامه

ا: لبن حاصل ناشی از وطی شرعی یا غیر شرعی؟

مذهب حنفیه معتقد است که مکیدن شیر زن، جهت نشر حرمت، مطلق است. بنابراین این مطلب که شیر زن حاصل از نکاح شرعی باشد و یا حاصل از وطی به شبهه و یا حاصل از زنا، اشکالی در جهت نشر حرمت به وجود نمی‌آورد.[1]

اما مذهب امامیه نشر حرمت را فقط از طریق مکیدن شیر حاصل از نکاح شرعی می‌داند. ایشان برای مکیدن شیر ناشی از زنا در جهت نشر حرمت، وجهی قائل نیستند.[2]

بند اول ماده ۱۰۴۶ قانون مدنی نیز بر این موضوع تاکید دارد.

ب: شرط مکیدن شیر

بین دو مذهب اختلاف است بین اینکه آیا شرط است شیر از طریق مکیدن به PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) برسد، و یا اینکه به هر طریقی به شکم طفل برسد، در نشر حرمت کفایت می‌کند.

حنفیه صرف رسیدن شیر به دهان و شکم طفل را موجب نشر حرمت می‌دانند.[3]

ولی امامیه یکی از شرایط نشر حرمت را ارضاع طفل از طریق مکیدن، می‌‌دانند.[4]

بند دوم ماده ۱۰۴۶ قانون مدنی نیز موید این موضوع است.

ج: میزان لبن

در مورد مقداری از نوشیدن شیر که موجب نشر حرمت می‌شود، امامیه شروطی را قائل هستند. از جمله اینکه در دو سال اول زندگی باشد، تعداد ۱۰ یا ۱۵ بار متوالی باشد، استخوان محکم کند و یا گوشت برویاند، و مواردی از این قبیل.[5]

بند سوم ماده ۱۰۴۶ قانون مدنی طفل لااقل یک شبانه روز و یا 15 دفعه متوالی شیر کامل خورده باشد بدون اینکه در بین غذای دیگر یا شیر زن دیگر را بخورد.

ولی در فقه حنفی صرف مکیدن شیر جهت نشر حرمت کفایت می‌کند و میزان خاصی برای آن قائل نیستند.[6]

 

[1] لا فرق بین أن تکون المرأه بکرا، أو ثیّبا، و لا بین أن تکون متزوجه، أو غیر متزوجه متى کان لها لبن یشربه الرضیع.همان، ص۳۱۷.

[2] بحیث یکون اللبن من حملها ذلک عن نکاح أو وطء صحیح بالعقد أو الملک أو التحلیل أو شبهه فلا حکم للبن البهیمه أی غیر الآدمیه عندنا و عند أکثر أهل العلم. فاضل هندى، محمد بن حسن، کشف اللثام و الإبهام عن قواعد الأحکام، 11 ج، دفتر انتشارات اسلامى وابسته به جامعه مدرسین حوزه علمیه قم، قم - ایران، اول، 1416 ه‍ ق، ج۷، ص۱۲۸.

 

[3] ولا فرق بین أن یصل اللبن إلى الجوف من طریق الفم بمص الثدی أو بصبه فی حلقه أو إدخاله من أنفه، فمتى وصل اللبن إلى معده الطفل أثناء مده الحولین المذکورین بالشروط الآتیه کان رضاعاً شرعیاً علیه التحریم الآتی بیانه. جزیری، عبدالرحمن، الفقه علی المذاهب الاربعه، ج۴، ص۲۲۶.

[4] یشترط أن یمتص الرضیع اللبن من الثدی. مغنیه، محمد جواد، الفقه على المذاهب الخمسه، ج۲، ص۳۱۷.

[5] نجفی، محمد حسن، جواهرالکلام فی شرح شرایع الاسلام، ج۲۹، ص۲۶۹.

[6] أما الحنفیه. والمالکیه فإنهم خالفوا هذا ولم یشترطوا عدداً، بل قالوا: کل ما وصل إلى جوف الصبی من لبن المرضعه ولو قلیلاً یوجب التحریم، وقد عرفت اختلافهم فی التفصیل المتقدم. جزیری، عبدالرحمن، الفقه علی المذاهب الاربعه، ج۴، ص۲۲۸.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:51:00 ق.ظ ]




نکاح در عده

در خصوص حرمت نکاح در عده مذهب امامیه اعتقاد به حرمت و در موارد خاصی قائل به ایجاد حرمت ابدی بین زوجین است. نکاح با زن در عدّه در صورت علم موجب حرمت ابدى است؛ یعنى علم به حکم و موضوع. در مسأله فرقى نمى‌کند که هر دو عالم به حکم و موضوع باشند و یا اینکه فقط یکى از آنان علم داشته باشد به هرحال به محض وقوع چنین عقدى حتّى اگر نزدیکى هم صورت نگرفته باشد حرمت ابدى بین آنان ایجاد مى‌شود.

تحقیق - متن کامل - پایان نامه

ایشان با استناد به روایات مختلف فتوی بر این مطلب نموده‌اند که در صورتى که این ازدواج با علم باشد و یا با جهل و لیکن نزدیکى صورت گرفته باشد، موجب حرمت ابدى خواهد بود. و امّا در حالت جهل بدون نزدیکى موجب حرام ابدى نمى‌گردد، ولى در تمام این صور عقد باطل است.[1]

ماده1050 قانون مدنی می‌گوید: «هر کس زن شوهر دار را با علم بوجود علقه زوجیت و حرمت نکاح و یا زنی را که در عده طلاق یا در عده وفات است با علم بعده و حرمت نکاح برای خود عقد کند عقد باطل و آن زن مطلقا بر آن شخص حرام موبد می‌شود».

و نیز در ماده1051 می‌گوید: «حکم مذکور در ماده فوق در موردی نیز جاری است که عقد از روی جهل بتمام یا یکی از امور مذکوره فوق بوده و نزدیکی هم واقع شده باشد در صورت جهل و عدم وقوع نزدیکی عقد باطل ولی حرمت ابدی حاصل نمی‌شود».

اما مذهب حنفی اگر چه در بطلان نکاح در عده با امامیه هم عقیده است، ولی وجهی برای نشر حرمت قائل نیست. ودلیلی برای این مطلب نمی‌بیند.[2]

گفتار نهم: نکاح در زمان احرام

مذهب امامیه احرام را از موانع نکاح، و نکاح در زمان نکاح را باطل می‌داند. اگر انعقاد نکاح همراه با علم به موضوع و حکم حرمت باشد، حرمت ابدی بین زن و مرد حاصل می‌شود. ولی اگر جهل به هر دو داشته باشد، حرمت موقت است وبا رفع احرام و عده نکاح جایز است. ولی مذهب حنفیه اشکالی در نکاح در حال احرام نمی‌بیند و قائل به صحت چنین نکاحی است.[3]

مبحث هفتم: ولایت در نکاح

در این مبحث به بررسی موارد اختلافی در مبحث ولایت در نکاح بین مذفه حنفی و امامی پرداخته می‌شود.

گفتار اول: ولایت بر بالغه رشیده

در کلیت عدم ولایت بر بالغه رشیده بین دو مذهب اختلافی نیست.

در مذهب امامی در اینکه پدر و جدّ پدرى بر بالغۀ غیر باکره هیچ‌گونه ولایتى ندارد و نکاح چنین دخترى موکول به ارادۀ خود اوست. امّا در مورد دختر بالغۀ باکره اختلاف نظر وجود دارد. قانون مدنی به تبعیت از نظر اکثریت ولایت ولی را مقید به قیود خاصی می‌داند. مادّه 1043 قانون مدنى می‌گوید: «نکاح دخترى که هنوز شوهر نکرده اگر چه به سنّ بلوغ رسیده باشد، موقوف به اجازه پدر یا جدّ پدرى اوست، و هرگاه پدر یا جدّ پدرى بدون علّت موجّه از دادن اجازه مضایقه کند دختر مى‌تواند با معرفى کامل مردى که مى‌خواهد به او شوهر کند و شرایط نکاح و مهرى که بین آنها قرار داده شده، به دادگاه مدنى خاص مراجعه و به توسط دادگاه مزبور مراتب به پدر یا جدّ پدرى اطلاع داده شود، و بعد از 15 روز از تاریخ اطلاع و عدم پاسخ موجّه از طرف ولى دادگاه مزبور مى‌تواند اجازه نکاح را صادر نماید».

ولی در مذهب حنفی اگر دختر بالغه رشیده با مردی غیر کفو و یا به میزان کمتر از مهرالمثل ازدواج کند، ولی می‌تواند فسخ چنین نکاحی را از حاکم بخواهد.[4]

[1] نجفی، محمد حسن، جواهرالکلام فی شرح شرایع الاسلام، ج۲۹، ص۴۳۱.

[2] یفرق بینهما، فإذا انقضت العده فلا مانع من تزویجه بها ثانیه. ابن رشد، بدایه المجتهد و نهایه المقتصد، ۲ج، دارالکتب الاسلامیه، قاهره، ۱۴۰۳ه.ق. ج۲، ص۱۳۹.

[3] قال الإمامیه: المحرم للحج أو للعمره لا یتزوج و لا یزوج رجلا کان أو امرأه، وکیلا أو ولیا، و ان حصل الزواج کان باطلا، لحدیث «لا ینکح المحرم، و لا ینکح، و لا یخطب». و قال الحنفیه: الإحرام لا یمنع من الزواج. و قال الإمامیه: إذا حصل العقد حال الإحرام فإن کان مع الجهل‌ بالتحریم حرمت المرأه مؤقتا، فإذا أحلا، أو أحل الرجل، ان لم تکن المرأه محرمه جاز له العقد علیها، و ان کان مع العلم بالتحریم فرق بینهما و حرمت مؤبدا. مغنیه، محمد جواد، الفقه على المذاهب الخمسه، ج۲، ص۳۱۷.

[4] قال الحنفیه: للبالغه العاقله إن تنفرد باختیار الزوج، و ان تنشئ العقد بنفسها بکرا کانت أو ثیبا، و لیس لأحد علیها ولایه و لا حق الاعتراض، على شریطه ان تختار الکفؤ، و أن لا تتزوج بأقل من مهر المثل، فان تزوجت بغیر الکفؤ یحق للولی أن یعترض، و یطلب من القاضی فسخ الزواج، و ان تزوجت بالکفو على أقل من مهر المثل، یطلب الفسخ إذا لم یتمم الزوج مهر المثل. ابوزهره، محمد، الاحوال الشخصیه، دارالفکر العربی، قاهره، ۱۴۱۶ه.ق.، ص۳۶۴.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:50:00 ق.ظ ]




هیدرولوژی

در بخشی از اراضی مورد مطالعه که مورد کشت قرار می گیرد تعداد زیادی چاه عمیق حفر گردیده که با استناد به نتایج آزمایشگاهی و بر اساس طبقه بندی آب ها جزء کلاس C3S1 ( نسبتاً مناسب جهت آبیاری ) قرار می گیرد .

ناحیه مطالعاتی شاهرود از نظر تقسیمات هیدرولوژیک بخشی از گستره حوزه آبریز بزرگ کویر مرکزی است . جریان ابهای سطحی ناحیه از تعدادی رودخانه دایمی، اصلی و سیلابی تشکیل شده است. جریانهای دایمی منحصر به ارتفاعات البرز، واقع در شمال ناحیه و جریانهای فصلی و سیلابی نیز در سراسر گستره ناحیه پراکنده است.

 

1-4-3- منابع آب 

حوزه آبریز شهرستان شاهرود با وسعتی معادل 50889  کیلومتر مربع جزء حوضه آبریز استان مازندران می باشد. ارتفاعات 35 درصد , دشتها 25 درصد و مناطق کویری و بیابانی بیش از 40 درصد از وسعت این شهرستان را در بر می گیرند. سطح مفید حوضه آبریز شاهرود از نظر تولید جریانهای سطحی , کمتر از نصف مساحت حوضه آبریز این شهرستان است.

از نظر میزان نزولات جوی و توزیع فصلی و مکانی آن و میانگین بارندگی آن در سال که 124 میلیمتر است وضع نامناسبی دارد که در نتیجه آن از منابع آب سطحی و زیرزمینی کافی و غنی برخوردار نمی باشد و ظرفیت منابع داخلی این حوزه بسیار ضعیف است. ولی با این حال مسیلهایی از ارتفاعات البرز سرچشمه گرفته و از شمال به جنوب جریان می یابد که پس از تغذیه دشتهای حاشیه مسیر خود به کویر مرکزی و کویر نمک منتهی می گردند. این مسیلها دارای حوزه های فرعی نیز هستند که مهمترین آنها , تاش , مجن و کال شور می باشند.

- رودخانه تاش

این رودخانه در شهرستان شاهرود از دره های جنوبی شاهکوه گرگان و حدود تاش و مجن از سمت شمال کوه های البرز سرچشمه می گیرد و پس از اتصال با چندین رود کوهستانی به سمت دشت کویر سرازیر می شود.

- رودخانه کال شور

این رودخانه از قسمت بخش میامی شاهرود جریان می گیرد و از زیر پل ابریشم واقع در محور شاهرود ـ سبزوار می گذرد و اراضی اطراف را سیراب می نماید و در نهایت در شرق میامی وارد کویر می شود.

- رودخانه کال دستجرد

کال دستجرد که در حدود 60 کیلومتری جنوب کال شور میامی قرارداشته و زهکشی اراضی اطراف بیارجمند به شمار می رود. این رودخانه فاقد جریان دائم است.

 

5-3-پوشش جنگلی و مراتع

- پوشش جنگلی 

فضای جنگلی استان دارای ویژگیهای زیر است جنگلهای طبیعی شامل جنگل های پهن برگ حاشیه شمالی استان که ادامه جنگل های کوهستانی شمال کشور است و در ارتفاع 900 تا 2500 متر از سطح دریا قرار گرفته اند.

جنگل های ارس دامنه های جنوبی رشته کوه البرز که در ارتفاع 1700 تا 2400 متری از سطح دریا قرار گرفته است. این جنگلها ها از اهمیتی ویژه برخوردارند. بطوریکه در جنگل های ارس چهار باغ شاهرود که متراکم ترین جنگل های ارس منطقه هستند درختانی تا ارتفاع 15 متر وجود دارد.

- مراتع :

مراتع موجود در سطح شهرستان شاهرود برابر با 147/3  میلیون هکتار می باشد که از این تعداد 115 هزار هکتار جزء مراتع خوب , 310 هزار هکتار جزء مراتع متوسط و 652/1 میلیون هکتار جزء مراتع ضعیف و 07/1 میلیون هکتار فقیر می باشد. همچنین تولید علوفه در مراتع این شهرستان برابر 347950  تن می باشد که از این مقدار 51750 تن ( 9/14 درصد ) از مراتع خوب و مقدار 77500 تن ( 3/22 درصد ) از مراتع متوسط و مقدار 165200 تن ( 4/47 درصد ) از مراتع ضعیف و مقدار 53500 تن ( 4/15 درصد ) نیز از مراتع فقیر بدست می آید.

 

موضوعات: بدون موضوع  لینک ثابت
 [ 08:49:00 ق.ظ ]




مناطق حفاظت شده زیست محیطی :

- منطقه توران ( حفاظت شده و پناهگاه حیات وحش)

این منطقه در جنوب شرقی شاهرود واقع شده و به استناد مصوبه شورای عالی حفاظت محیط زیست در سال 1351 و تجدید نظر شده برابر مصوبه شماره 75 سال 1355 تحت عنوان پناهگاه حیات وحش و حفاظت شده توران ذخیره گاه بیوسفر حفاظت می گردد.

عکس مرتبط با محیط زیست

توران از لحاط وسعت، دومین منطقه حفاظت شده ایران بوده و به سبب وسعت زیاد خود یکی از معدود مناطقی بوده که توانسته تا حد زیادی از گزند بسیاری از آسیبهای انسانی در طول سالهای گذشته مصون بماند. این منطقه یکی از مناطقی است که گونه های متنوعی از پستانداران و پرندگان را در خود جای داده و بیشترین جمعیت گورخر را در ایران داراست. همچنین تعداد نسبتا بالایی قوچ و میش، کل و بز، آهو و جبیر در آن یافت میشود. هم چنین در حدود 12 تا 15 قلاده یوزپلنگ در خارتوران زیست نموده و مشاهده این حیوان با توله هایش در سالهای اخیر, نوید افزایش جمعیت یوزپلنگ را در این منطقه می دهد. توران پناهگاه یکی از دو جمعیت باقی مانده گورخر آسیایی در ایران است و غیر از این گونه، جانوران ارزشمند دیگری از قبیل پلنگ، گرگ، کفتار وکاراکال نیز در این منطقه وجود دارند.

- منطقه خوش ییلاق (پناهگاه حیات وحش)

منطقه حفاظت شده خوش ییلاق در قسمت شمال شرقی شاهرود قرار گرفته و مساحت آن در حدود ۱۵۶ هکتار می‌باشد و حیوانات وحشی این منطقه نیز عبارت‌اند از: آهو، مرال، گورخر، یوزپلنگ، گربه وحشی، قاراکل، خرس، روباه، گرگ، شغال، تشی، خرگوش، ایبا، هوبره، قرقاول، تیهو و کبک.

پناهگاه حیات وحش خوش ییلاق واقع در استانهای گلستان و سمنان مشتمل بر کوههای قلندرسر،قراول خانه، میان کوه، تیل آباد، عباس تخته النگ و دشتهای زردابه ای، ری آباد است که طبق مصوبه شماره یک شورای عالی حفاظت محیط زیست از سال 1341 به عنوان پناهگاه حیات وحش شناخته شده است

- منطقه شکار ممنوع تپال

منطقه شکار ممنوع تپال با وسعتی برابر ۳۰ هزار هکتار در شمال غربی شهرستان شاهرود واقع شده و منطقه‌ای است کوهستانی و دشتی که در مجاورت شاهرود واقع شده‌است. منطقه تپال با چشم اندازهای بسیار زیبا از دیر زمان محل مناسبی جهت زیستگاه وحوش و محل مناسبی جهت بازدید دوستداران طبیعت به شمار می‌رود.

منطقه تپال با چشم اندازهای بسیار زیبا از دیر زمان محل مناسبی جهت زیستگاه وحوش و محل مناسبی جهت بازدید دوستداران طبیعت به شمار می رود .
این منطقه که تا قبل از سال 1373 از نظر حیات وحش دچار آسیبهای جدی شده بود جهت احیا ء آن طبق آگهی روزنامه رسمی به مدت 5 سال از سوی شورایعالی حفاظت محیط زیست به عنوان منطقه شکار ممنوع و تحت حفاظت قرار گرفت که پس از انقضای این مهلت از اول آذر ماه سال 1377 به مدت 5 سال دیگر منطقه شکار ممنوع اعلام گردید هاست این منطقه به لحاظ نزدیکی و مجاورت شهرستان شاهرود و مجن از موقعیت خاصی برخوردار بوده و دسترسی به این منطقه برای گردشگران و دوستداران طبیعت با کمترین زمان و هزینه امکان پذیر می باشد

. از گونه‌های بارز حیات وحش این منطقه می‌توان قوچ و میش، کل و بز، آهو، خرس قهوه‌ای، پلنگ، کبک، کیهو، کبک دری، شغال، و انواع پرندگان وحشی را می‌توان نام برد.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:47:00 ق.ظ ]




ویژگی های اقلیمی

شهرستان شاهرود به دلیل موقعیت خاص جغرافیایی و قرار گرفتن در کنار سلسله جبال البرز از یک طرف و کویر مرکزی از طرف دیگر و همچنین قرار گرفتن در مسیر توده هواهای مختلف ، آب و هوای گوناگونی دارد.   بر اساس مطالعات زیست اقلیمی ایران ، شهرستان شاهرود دارای اقلیم نیمه بیابانی خفیف است. از لحاظ اقلیمی شهرستان شاهرود ، در بخش شمالی دارای اقلیم کوهستانی و سردسیر ، در بخش مرکزی دارای اقلیم معتدل و در بخش جنوبی دارای اقلیم گرم و خشک است.

نزدیکترین  توده بزرگ آبی به ناحیه مطالعاتی ، دریاچه خزر در شمال ان است. ار چه وجود ارتفاعات البرز در شمال ناحیه مانعی بر سر نفوذ رطوبت آن به شهرستان می باشد، با این حال شرایط اب و هوایی شاهرود، بویژه قسمتهای شمالی آن کم و بیش تحت تاثیر این توده قراردارد. بجز دریای خزر هیچ توده آبی قابل توجهی (طبیعی یا مصنوعی) که بر اقلیم ناحیه تاثیر داشته باشد در داخل محدوده و مناطق پیرامونی آن وجود ندارد.

دانلود تحقیق و پایان نامه

جریانهای عمومی آب و هوایی مهمترین عامل موثر بر شرایط آب و هوایی منطقه است. این جریانها یا سیستم های هوایی که در ایران و از جمله شاهرود تاثیر زیادی می گذارند، اغلب مراکز کم فشار و پرفشارهایی هستند که در نیمکره شمالی و برروی فلات ایران و یا در داخل و خارج آن تشکیل می شوند. مهمترین این مراکز عبارتند از:

  • سیستم کم فشار مدیترانه ای
  • توده هوای منطقه سیبری
  • توده هوایی فشارهای کم قطبی

توده هوای پرفشار فوق استوایی

 

بر اساس آمار دهساله 79-88 ایستگاه هواشناسی شاهرود وبراساس نمودارهای ترسیمی 2-4و3-4و4-4-متوسط میزان بارندگی سالیانه 3/145 میلی متر و متوسط درجه حرارت سالیانه 8/15 درجه سانتیگراد و بالاترین معدل حداکثر درجه حرارت 7/32 درجه سانتیگراد در تیرماه و کمترین معدل حداقل درجه حرارت در دی ماه 3/2- درجه سانتیگراد می باشد .میزان رطوبت متوسط سالیانه6/46درصدبوده است .

باد دامغان که از سمت جنوب غرب در فصل های پاییز و بهار می وزد . باد شمال که از سمت شمال در بیشتر فصول سال می وزد و باد خراسان که از بادهای محلی خراسان است که بر اثر اختلاف فشار و دما بوجود می آید و از شرق به غرب در 3 ماهه زمستان می وزد. باد قبله نیز از سمت جنوب می وزد که وزش آن در ماه های گرم سال بوده و موجب افزایش درجه حرارت و خشکی هوا می شود.جهت این باد که شدت زیادی دارد، جنوب و جنوب غربی شاهرود است.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:46:00 ق.ظ ]




تاریخچه جنس اسینتوباکتر بومانی:

اوایل قرن 20 در سال 1911 میلادی میکروبیولوژیست آلمانی بنام بیجرینگ ارگانیسمی بنام Calcoaceticus micrococcus  را از خاک جدا کرد(.طی دهه های بعد ارگانیسم های مشابهی توصیف شدند که شامل 15 گونه و جنس متفاوت بودند که می توان از آنها نام برد( پلگ و همکاران،2008) :

Herellea vaginicol ،Niesseria winogradskyi ،Acromobacter anitratus,

Bacterium anitratum ،Alcaligenes heamolysans ،Diplococcus mucosus,

Micrococcus calcoaceticus، Mima polymorpHa ،Achromobacter mucosus,

Akinetos نام یونانی جنس رایج اسینتوباکتر می باشد که به معنی غیر متحرک می باشد که درسال 1954 توسط بریشوو پریوت برای جدا کردن میکروارگانیسم های غیر متحرک از متحرک های جنس  آکروموباکتر به کار گرفته شد.

2-2.تاکسونومی رایج اسینتوباکتر بومانی:

اسینتوباکتر(A) کوکوباسیل گرم منفی است که اخیرا در خانواده جدید Moraxelaceae و راسته Gammaproteobacteria قرار می گیرند(روساو و همکاران، 1991).

در سال 1986 مطالعاتی بر پایه هیبریداسیون DNA-DNA انجام شد که از 12 گروه DNA 2سویه اصلی A. baumannii, A. calcoaceticus تشخیص داده شد(بویووت و گریمونت 1986).

همچنین به تدریج از گیاهانی که در فاضلاب بودند و به صورت لجن درآمده بودند 7 گونه جدا شد که به آن اشاره شده( کار و همکاران ، 2007) :

  1. Tandoii, A. grimonti, A. galcoaceticus, A. gerneri, A.bouvetti,
  2. baylyi, A. Towneri, A.tjerbergiae, A. baumanni ,

 

2-3.شناسایی گونه های اسینتوباکتر:

اسینتوباکترها بصورت کوکوباسیل و گرم منفی بوده ولی رنگ آمیزی بسیار سختی دارند به همین دلیل گاهی اشتباها این باکتری بصورت کوکسی گرم منفی و یا گرم مثبت دیده می شود. برای نگهداری اسینتوباکتر با منشا انسانی می توان از محیط کشت بلاد آگار تهیه شده با خون گوسفندی استفاده کرد.  بیشتر گونه های اسینتوباکتر کلنی های مات و کوچکی دارند به جزء کلنی های A.baumanni  , A. calcoaceticus  که مشابه کلنی انتروباکتریاسه 3-5/1میلی متر قطر دارند.سویه اسینتوباکتر همولیتیکوس و چندین سویه ی دیگر  که در حال حاضر به خوبی مشخص شده اند نظیر اسینتوباکتر بیوتیپ 13, BJ14, BJ15 16و17ممکن است بر روی محیط بلاد آگار تهیه شده توسط خون گوسفندی تولید همولیز کنند که این خصوصیت به هیچ عنوان در اسینتوباکترهایی که متعلق به کمپلکس A.baumanni ،A.calcoaceticus هستند مشاهده نشد.

دانلود پایان نامه

متاسفانه هیچ تست متابولیکی که تنها برای تشخیص اسینتوباکتر از دیگر باکتری های گرم منفی غیر تخمیری به کار گرفته شود وجود ندارد. استفاده از محیط کشت غنی شده با pH پایین که به شدت هوادهی شده و سرشار از ذخایر معدنی همراه با استات و یا دیگر منابع مناسب کربن و نیترات به عنوان منبع نیتروژن  می تواند روش مناسبی برای شناسایی بدون ابهام اسینتوباکتر از نمونه های محیطی و کلینیکی باشد.

استفاده از محیط کشت اسینتوباکتر جزء آسان ترین روش های شناسایی اسینتوباکتر از یک جمعیت باکتریایی مخلوط می باشد، ولی هیبریداسیون DNA-DNA به عنوان یک روش استاندارد بکار گرفته        می شود(پلگ و همکاران، 2008).

 

2-4.جایگاه طبیعی اسینتوباکتر بومانی:

اسینتوباکتر بومانی جزء باکتری هایی هستند که از تمام نمونه های جمع آوری شده از خاک و سطح آب قابل جداسازی  می باشند در نتیجه می توان گفت در همه جا حضور دارند. بیشتر گونه های اسینتوباکتر که از نمونه های کلینیکی انسانی جدا شده اند حداقل یک سری از ویژگی ها را به عنوان پاتوژن های انسانی دارا هستند.در بررسی های اپیدمیولوژی که بر روی پوست و اعضای موکوئیدی انسان انجام شد 43% از افرادی که در بیمارستان بستری نبودند، حامل این باکتری بر روی پوست خود بودند که نشان  می دهد این باکتری جزئی از فلور نرمال پوست انسان می باشد که بیش ترین گونه های یافت شده، اسینتوباکترلوفی، اسینتوباکتر جانسونی، اسینتوباکتر جونی و اسینتوباکتر بیوتیپ 3 بود (پلگ و همکاران ،2008). و این در صد در افرادی که در بیمارستان ها بستری شده اند به 75% و حتی بالاتر هم رسیده است ( برلو و همکاران ، 1999 ).

برلو سبزیجات انگلستان را مورد آزمایش قرار داد و دریافت که از 177 نمونه سبزیجات آزمایش شده،  کشت 30 نمونه (17%) از نظر وجود اسینتوباکتر مثبت بوده، همچنین اسینتوباکتر بومانی و اسینتوباکتر بیوتیپ11 در این میان شایع ترین گونه ها بودند( برلو و همکاران ،1999). میزان انتقال اسینتوباکتر بصورت مدفوعی مورد مطالعه قرار گرفت و نشان داده شد که 25% افراد سالم بصورت ناقل هستند که از همه مهمتر اسینتوباکتر جانسونی و اسینتوباکتر بیوتیپ 11 می باشد (پلگ و همکاران ،2008 ).

 

Beijerinck

Peleg

Brisou

[4] Prevot

Acinetobacter

Rossau

Bouvet,Grimont

Carr et al.

Berlau et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:44:00 ق.ظ ]




فاکتورهای بیماری زایی اسینتوباکتر:

در مورد فاکتورهای بیماریزایی اسینتوباکتر اطلاعات کمی در دسترس بوده است، ولی اخیرا اطلاعاتی نظیر بدست آوردن تعیین توالی ژنوم اسینتوباکتر به ما کمک می کند تا جزایر پاتوژنیستی و آرایش مقاومت دارویی اسینتوباکتر بومانی را مشخص کنیم.

در ارتباط با تعدادی از ژن های مشخص شده که مقاومت آنتی بیوتیکی، مقاومت فلزات سنگین و    آنتی سپتیک را کد می کردند پاتوژن های دیگری نظیر سودوموناس، سالمونلا و اشریشیاکلی وجود دارند که نشان دهنده ی این است که انتقال ژنتیکی عوامل ویرولانس نیز امکان پذیر می باشد.

پس از انجام دادن چندین موتاسیون تصادفی در سویه ی ATCC اسینتوباکتر بومانی Smit توانست چندین موتانت را در جزیره  پاتوژنیسیته متفاوت، با ویرولانس خفیف توسط مدل های Gaenohabtidis elegans و Dictyostelium که مدل های غیر پستانداران بودند مشخص کند.

ژن موتاسیون یافته مربوط به فاکتورهای رونویسی، سیستم های انتقال چند دارو به خارج و اوره آز بودند. متاسفانه ویرولانس این موتانت ها در مدل های پستانداران بررسی و پیاده نشد. وقتی ژنوم اسینتوباکتر بومانی با ژنوم A.baylyi که بیماری زا می باشد مقایسه شد مشخص گردید که 28 دسته ی ژنی در آن وجود دارد که تنها مختص به اسینتوباکتر بومانی می باشد که 16 تا از این ژن ها توانایی ایجاد تهاجم و بیماری زایی را داشتند.

یکی از جالب ترین آنها یک جزیره ی 133740 جفت بازی بود که نه تنها حاوی ترانسپوزون ها و اینتگرازها بود بلکه واجد ژن هایی بود که مشابه سیستم ویرولانسی، ترشحی تیپ IV در Legionella/Coxiella بود.(توماراس و همکاران،2003)

دیگر ژن ها شامل آن هایی بود که در تشکیل پوشش سلولی، بیوژنز پیلوس، جذب و متابولیسم آهن نقش داشتند. مطالعات بیشتری که بر روی مکانیسم های اختصاصی بیماری زایی در اسینتوباکتر بومانی صورت گرفت بر روی سیستم اکتساب آهن بر پایه ی سیدروفورها و شکل گیری بیوفیلم ها و پیوستگی و عملکرد OMP و LPS اسینتوباکتر بومانی متمرکز بود. توانایی اسینتوباکتر بومانی برای چسبیدن به سطوح و تشکیل بیوفیلم ها بر روی اجسام بی جان علت پایداری این ارگانیسم ها در محیط بیمارستان بود.توماراس نشان داد که شکل گیری بیوفیلم در اسینتوباکتر بومانی به طور فنوتیپی همراه با شکل گیری پیلوس و تولید اگزوپلی ساکارید بود.

آنالیز بیشتر توالی ها مشخص کرد، اپرون پلی سیسترونیک Csu شامل 5ژن است که شبیه ژن هایی    می باشد که پروتئین های مربوط به چاپرون و همچنین پروتئین هایی را که در تجمع پیلوس در دیگر باکتری های گرم منفی نقش دارد را کد می کند. چسبندگی اسینتوباکتر بومانی به سلول های اپیتلیال برونش انسان و گلبول های قرمز به علت وجود ساختاری شبه پیلوس بوده که در ایجاد این چسبندگی نقش دارد.

اسینتوباکتر بومانی پس از اتصال به سلول های انسان، می تواند باعث تحریک خودکشی سلول توسط OMP شود.این پروتئین در میتوکندری تجمع پیدا کرده و منجر به خودکشی سلول از دو مسیر وابسته به کاسپاز و مسیر مستقل می شود.

 

2-6.منشا کلینیکی عفونت های اسینتوباکتر بومانی:

2-6-1.مننژیت:

مننژیت جزء بیماریی هایی محسوب می شود که بیشتر توسط پاتوژن های گرم منفی اتفاق می افتد که اسینتوباکتر بومانی جزء این پاتوژن ها می باشد و باعث 70% مرگ و میر می شود (متان و همکاران ، 2007 )

 

2-6-2.عفونت خون:

در طی سال های 1995 تا 2002 مطالعاتی که بر روی عفونت های بیمارستانی در آمریکا انجام شد نشان داد اسینتوباکتر بومانی مسئول 3/1% تمام عفونت های تک میکروبی بیمارستانی در محیط خون بوده که جزء دهمین عامل رایج امراض محسوب می شود.

اسینتوباکتر بومانی باعث ایجاد 6/1% عفونت های خونی در بخش مراقبت های ویژه) ( ICU است ولی در محیط خارج از ICU 9/0% باعث ایجاد عفونت های خونی می شود. میزان مرگ ومیر ایجاد شده توسط  اسینتوباکتر بومانی در محیط خون 34 تا 4/43% در ICU و3/16% در محیط خارج از ICU بود.

اسینتوباکتر بومانی تقریبا 26 روز پس از بستری شدن عفونت های خونی ایجاد می کند و سودوموناس آئروژینوزا و کاندیدا رتبه ی بالای مرگ و میر را در محیط ICU دارا می باشند (ویسپیلینگوف و همکاران- ،2003)

Tomaras et al.

Metan et al.

Intensive-care unit

Wisplinghoff et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:43:00 ق.ظ ]




منشا کلینیکی عفونت های اسینتوباکتر بومانی:

2-6-1.مننژیت:

مننژیت جزء بیماریی هایی محسوب می شود که بیشتر توسط پاتوژن های گرم منفی اتفاق می افتد که اسینتوباکتر بومانی جزء این پاتوژن ها می باشد و باعث 70% مرگ و میر می شود (متان و همکاران ، 2007 )

دانلود پایان نامه

 

2-6-2.عفونت خون:

در طی سال های 1995 تا 2002 مطالعاتی که بر روی عفونت های بیمارستانی در آمریکا انجام شد نشان داد اسینتوباکتر بومانی مسئول 3/1% تمام عفونت های تک میکروبی بیمارستانی در محیط خون بوده که جزء دهمین عامل رایج امراض محسوب می شود.

اسینتوباکتر بومانی باعث ایجاد 6/1% عفونت های خونی در بخش مراقبت های ویژه) ( ICU است ولی در محیط خارج از ICU 9/0% باعث ایجاد عفونت های خونی می شود. میزان مرگ ومیر ایجاد شده توسط  اسینتوباکتر بومانی در محیط خون 34 تا 4/43% در ICU و3/16% در محیط خارج از ICU بود.

اسینتوباکتر بومانی تقریبا 26 روز پس از بستری شدن عفونت های خونی ایجاد می کند و سودوموناس آئروژینوزا و کاندیدا رتبه ی بالای مرگ و میر را در محیط ICU دارا می باشند (ویسپیلینگوف و همکاران- ،2003)

 

2-6-3.عفونت های دستگاه ادراری:

اسینتوباکتر بومانی یکی از عوامل فرعی ایجاد کننده ی عفونت های دستگاه ادراری، که مسئول 6/1% عفونت های مجاری ادراری در ICU می باشد، به طور معمول این ارگانیسم همراه با عفونت های ایجاد شده در زمان استفاده از کاتتر مرتبط می باشد ( باستی و همکاران ، 2008 ).

 

2-6-4. پنومونی بیمارستانی:

در مطالعات انجام شده بر روی بیماران بستری در ICU مشخص شده که 5 تا 10% این افراد در اثر وجود باکتری اسینتوباکتر بومانی به پنومونی مبتلا شده اند و شکی نیست که پنومونی وابسته به ونتیلاتور(VAP) در اثر اسینتوباکتر بومانی رخ  می دهد(گاینس و ادوارد ، 2005 ).

 

2-7. عفونت های بیمارستانی:

عفونت های بیمارستانی به بروز یک بیماری جدید در فرد اطلاق می شود که در اثر بستری فرد در بیمارستان رخ می دهد که در بخش مراقبت های ویژه ICU بیشتر از سایر بخش ها مشکل ایجاد می کند       ( یربن و همکاران ، 2003 ).

مهم ترین راه انتقال عفونت از طریق دست های شسته نشده حاملین یعنی پرسنل بیمارستان می باشد. نقش عفونت های بیمارستانی در افزایش مورتالیتی، موربیدیتی و افزایش هزینه های بیمارستانی به خوبی روشن شده است و همچنین عفونت های بیمارستانی بعد از بیماری های قلبی عروقی، سرطان ها و عفونت ناشی از اجتماعات، چهارمین عامل معمول در مرگ و میر می باشد بنابراین درمان مناسب عفونت ها از اهمیت حیاتی برخوردار است. درمان مناسب شامل استفاده از دارو در یک دوره زمانی مناسب، شروع درمان ضد میکروبی در مراحل اولیه عفونت و استفاده از عوامل ضد میکروبی صحیح  می باشد( نجاری و همکاران،2003).

یکی از مهم ترین مشکلات در مورد عفونت های بیمارستانی ،انتشار قطعی مقاومت دارویی می باشد. مقاومت نسبت به عوامل ضد میکروبی در بین انواع زیادی از پاتوژن ها به خصوص پاتوژن های دخیل در عفونت های بیمارستانی، انتشار گسترده یافته است که به مشکل شدن درمان عفونت ها منجر می گردد و این امر سبب افزوده شدن میزان مرگ و میر در بیماران می شود به طوری که یک سوم از بیماران بزرگسال بد حال بستری در ICU به دلیل بیماری زمینه ای و کاهش ایمنی بدن آن ها بر اثر بیماری همراه عفونت، فوت        می شوند.

یک راه طبقه بندی عفونت ها در ICU بر اساس معیار زمان می باشد و بروز عفونت پس از 48 ساعت از پذیرش در ICU ، عفونت بیمارستانی در نظر گرفته می شود. راه دیگر طبقه بندی بر اساس حالت حاملین می باشد که در این طبقه بندی، عفونت اندوژن اولیه هم توسط بیمار حمل شده است و عفونت اندوژن ثانویه توسط میکروارگانیسم هایی بروز می نماید که بعد از پذیرش در ICU کسب شده باشند که معمولا این ارگانیسمها به گروه باکتری های غیر معمول مثل باسیل های گرم منفی هوازی و استافیلوکوکوس اورئوس مقاوم به متی سیلین تعلق دارند.

باکتری های کومنسال مانند اشریشیاکلی و استافیلوکوک ها عمدتا باعث ایجاد عفونت های بیمارستانی  می شود.طیف پاتوژنهای بیمارستانی در دهه گذشته تغییر یافته است به طوری که کوکسی گرم مثبت مثل استافیلوکوک ها و انتروکوک ها به تدریج مغلوب باکتری های گرم منفی شده اند و پاتوژن های قارچی، بخصوص در جمعیت بیماران ضعیف از نظر ایمنی اهمیت بیشتری را کسب کرده اند

( لیبراتی و همکاران، 2004 ).

 

Metan et al.

Intensive-care unit

Wisplinghoff et al.

Bassetti et al.

Ventilator associated pneumonia

Gaynes,Edward

Urban et al.

Nejjari et al.

Liberati et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:41:00 ق.ظ ]




استراتژی های درمانی عفونت های اسینتوباکتر بومانی:

قبل از سال 1970،درمان عفونت های ایجاد شده توسط اسینتوباکتر به وسیله ی تعدادی ازآنتی بیوتیکها نظیر بتالاکتام ها، آمینوگلیکوزیدها وتتراسایکلین ها امکان پذیر بوده ولی هم اکنون مقاومت به تمام آنتی بیوتیک های شناخته شده در اسینتوباکتر بومانی قابل مشاهده است و همین امر بیشتر متخصصان را در یک قلمرو نامشخص قرار داده و درمان های سودمند و رایج آنتی بیوتیکی را تحت مخاطره قرار داده است

( فالاگاس و بلیزیوتیس، 2007 ).

 

2-9. داروهای ضد میکروبی رایج:

انتخاب آنتی بیوتیک ها برای درمان تجربی هنوز هم مورد بحث قرار دارد و باید بر پایه ی آخرین میزان حساسیت اعلام شده توسط موسسات تجویز گردد. با وجود تنوع ایجاد کننده عوامل مقاومت در اسینتوباکتر بومانی، درمان باید بر پایه ی انجام تست های حساسیت آنتی بیوتیکی مناسب انجام بگیرد. کارباپنم دارویی است که بر ضد طیف وسیعی از سویه های اسینتوباکتر بومانی که در سطح جهان گسترده است نیز فعال       می باشد و برای درمان جدی عفونت های ایجاد شده توسط این باکتری مورد استفاده قرار می گیرد ( فالاگاس و بلیزیوتیس20 ، 2007 ).

 

2-9-1. پلی میکسین ها:

آنتی بیوتیک های پپتیدی نظیر پلی میکسین ها( کلی ستین، پلی میکسین E و پلی میکسینB) در نتیجه مقاومت سویه های اسینتوباکتر بومانی به تمام داروهای ضد میکروبی رایج شدند و در سال 1947 شناسایی و از باسیلوس پلی میکسا نشات گرفتند. این آنتی بیوتیک ها باعث جابجایی لیپیدها، آسیب دیدگی غشاء ناپایدار اسمزی می شوند به این صورت که مولکول های آنیونی لیپوپلی ساکارید(LPS) غشاء خارجی باکتری گرم منفی را مورد حمله قرار داده و باعث ایجاد واکنش بین غشاء خارجی و غشاء داخلی سلول شده و منجر به مرگ سلولی می شوند (کلیوسل و همکاران، 2007 ).

هم اکنون دو شکل تجارتی کلی ستین قابل دسترس است.کلی ستین متانوسولفات که برای مصارف تزریقی و دیگری کلی ستین سولفات که برای مصارف دهانی و موضعی می باشد . هر دو شکل می توانند به صورت تنفسی نیز مورد استفاده قرار یگیرند.

کلی ستین که به صورت تنفسی مصرف می شود به میزان زیادی باعث کاهش سمیت سیستماتیک و تقویت تاثیرگذاری دارو در جایگاه های عفونت می شود.

در تحقیقی که توسط سانگ انجام شد 86% افراد توسط سودوموناس آئروژینوزا و یا اسینتوباکتر بومانی، به پنومونی مبتلا شده بودند که این سویه ها به تمام آنتی بیوتیک ها به جزء پلی میکسین مقاوم بودند و      کلی ستین تنفسی دریافت می کردند و پاسخ میکروبیولوژی مناسبی مشاهده شد .

 

2-9-2.آمینوگلیکوزیدها:

اسینتوباکتر بومانی دارای ژن هایی است که آنزیم های تغییر دهنده آمینوگلیکوزیدها را در اینتگرون کلاس 1 کد می کنند و باعث ایجاد مقاومت به چندین دارو می شود.

طی گزارشی که از ژاپن اعلام شده ، در اسینتوباکتر بومانی سویه (armA) متیلاسیون 16SrRNA دیده شده است که باعث جفت شدن نواحی اتصال آمینوگلیکوزیدها با جایگاه هدف خودش می شود در نتیجه مقاومت بسیار بالایی به تمام آمینوگلیکوزیدهایی که از نظر کلینیکی مفید هستند نظیر توبرامایسین، جنتامایسین، آمیکاسین ایجاد می کند . ژن armA توسط پلاسمید انتقال می یابد و داخل ترانسپوزون قرار گرفته است.پمپ AbeM جزئی از خانواده پمپ های MATE می باشد که آمینوگلیکوزیدها، سوبستراهایی برای این پمپ   می باشند( مگنت و همکاران ، 2001 ).

2-9-3.سولباکتام:

سولباکتام ها در حقیقت یکی از سه مهارکننده ی بتالاکتاماز ها می باشند که این خاصیت آنها به علت اتصالشان به پروتئین متصل شونده به پنی سیلین می باشد( لوین، 2002 ). تحقیقاتی که در زمینه ی مقایسه ی فعالیت سولباکتام به تنهایی با حالتی که در ترکیب با بتالاکتام ها می باشد انجام شده است، به وضوح نشان   می دهد که فعالیت ذاتی سولباکتام ها بیشتر از توانایی آن ها برای مهار کردن بتالاکتامازها می باشد. حساسیت سویه های اسینتوباکتر بومانی به سولباکتام ها در شرایط آزمایشگاهی بسیار متفاوت است و وابسته به ناحیه ی جغرافیایی می باشد، بنابراین انجام تست های حساسیت با بهره گرفتن از روش مایع، بیش از روش دیسک دیفیوژن پیشنهاد می شود.

یوربن طی مطالعاتش در اسپانیا نشان داد که از 10 بیماری که آمپی سیلین-سولباکتام را به مدت بیشتر از 3 روز دریافت کرده بودند 9 تای آن ها از لحاظ کلینیکی پاسخ مثبت دادند و باکتری در آن ها ریشه کن شد    ( یوربن و ماریانو ، 1993 ). نتیجه ای که از این مطالعه بدست آمد ، این بود که مصرف آنتی بیوتیک های حاوی سولباکتام در درمان عفونت های خفیف تر در حقیقت یک راهکار مناسبی برای محدود کردن مصرف گسترده کارباپنم ها می باشد و هم اکنون داده های قابل اطمینان تری در دسترس است که تاثیر مثبت سولباکتام ها را در درمان عفونت های شدید ایجاد شده توسط اسینتوباکتر بومانی نشان می دهد.

در مطالعات آزمایشگاهی صورت گرفته نشان داده شد که زمانی که سولباکتام با داروهایی نظیر سفی پیم، ایمی پنم، مروپنم، آمیکاسین، ریفامپین و تیکارسیلین-کلاولانات مورد استفاده قرار بگیرد فعالیتش افزایش     می یابد( کوربلا و همکاران، 1998 ).

 

2-9-4. کینولون ها:

ایجاد جهش هایی در ژن های gyrA و parC، باعث ایجاد تغییراتی در DNA gyrase و یا توپوایزومراز IV می شود، که این موتاسیون باعث دخالت در جایگاه های اتصال هدف می گردد. مشابه آمینوگلیکوزیدها، بسیاری از کینولون ها سوبسترای پمپ های انتشار به خارج چندین دارو، نظیر پمپ های AdeABC که از نوع پمپ های RND و پمپ های AdeM که متعلق به پمپهای خانواده MATE هستند، می باشند. هم چنین مقاومت های کینولونی که مرتبط با پلاسمید است مربوط به ژن qnr می باشد که تاکنون درمورد اسینتوباکتر بومانی گزارش نشده است( میلاتوویک و همکاران، 2000 ).

Falagas, Bliziotis

lipopolyccharid

Clausell et al.

Magnet et al.

Levin

Corbella et al.

Milatovic et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:40:00 ق.ظ ]




تتراسایکلین ها و تایگلیسین ها:

مقاومت به تتراسایکلین ها و مشتقات آن ها مرتبط به پمپ ها و یا حفاظت ریبوزومی بود. وجود ژن های tet(A) تا  tet(E)ارگانیسم های گرم منفی که مسئول کد کردن پمپ های اختصاصی انتشار به خارج تتراسایکلین هستند نیز یک دلیل مقاومت محسوب می شود.

tet(A) و tet(B) در اسینتوباکتر بومانی شرح داده شد که tet(A) در یک ترانسپوزون مشابه با Tn1721 یافت شد و در ارتباط با عناصر IS بود. tet(A) باعث ایجاد مقاومت نسبت به تتراسایکلین می شد ولی بر علیه مینوسایکلین ها که داروی قوی تری برای اسینتوباکتر بومانی می باشد به کار نمی آید. جدا از پمپ های اختصاصی انتشار به خارج تتراسایکلین، اسینتوباکتر بومانی به داروهای ضد میکروبی هم چنین نسبت به پمپ های انتشار به خارج چندین دارو نظیر پمپ AdeABC نیز حساس هستند. تایگلیسین که اولین داروی ضد میکروبی از گروه تغییر یافته ی تتراسایکلین ها است نیز سوبستراهایی برای پمپ های انتشار به خارج   می باشد. با انجام دادن Real Time PCR بر روی ژن adeB، با افزایش MICs تایگلیسین، افزایش بیان adeB مشخص شد که منجر به کاهش MIC تایگلیسین از 4 میکروگرم بر میلی لیتر به 5/0 میکروگرم بر  میلی لیتر می شود(فلویت و همکاران، 2005 ).

 

2-9-6.آنتی بیوتیک های بتالاکتام:

دارای یک حلقه بتالاکتامی هستند که محل اثر آنتی بیوتیک ها می باشد، این حلقه به عنوان آنالوگ آسیل-د-آلانین-د-آلانین محکم به محل فعال آنزیم های ترانس پپتیداز، که ترانس پپتیداسیون واحدهای-Mur Nac را در دیواره ی سلول کاتالیز می کند، متصل می شود. آنتی بیوتیک های بتالاکتام مرگ سلولی را در پی دارند و باکتریوساید هستند و به دلیل تفاوت در دیواره سلولی باکتری های گرم مثبت و گرم منفی، طیف اثر دارو بر آن ها متفاوت می باشد(مدیروس و جکوبی، 1986 ).

این آنتی بیوتیک ها چهار دسته را شامل می شوند:

 

2-9-6-1.پنی سیلین ها:

ساختمان اصلی پنی سیلین ها از یک اسید آلی و یک حلقه ی بتالاکتامی تشکیل شده است و جزء    آنتی بیوتیک های وسیع الطیف با سمیت بسیار پایین بوده و دارای فعالیت باکتریوسایدی می باشند. از محیط کشت پنی سیلیوم کریزوژنوم به دست می آید و هسته ی اصلی ساختمان پنی سیلین ترکیب 6-آمینو           پنی سیلانیک اسید می باشد که فعالیت ضد میکروبی دارد و شامل یک حلقه ی پنج ضلعی تیازولیدین و یک حلقه ی چهار ضلعی بتالاکتامی است.

 

انواع پنی سیلین ها:

 

1-پنی سیلین های طبیعی:

  • فنوکسی متیل پنی سیلین(پنی سیلینV)
  • بنزیل پنی سیلین(پنی سیلین G)

2-پنی سیلین های نیمه صنعتی:

الف-پنی سیلین های وسیع الطیف:

  • آمینو پنی سیلین(آمپی سیلین،آموکسی سیلین، بک آمپی سیلین)
  • آمید ینوسیلین(پیوی میسیلینام)

ب-پنی سیلین های مقاوم به پنی سیلیناز: نافیسیلین، متی سیلین، ایزوکسازیل                             پنی سیلین(اگزاسیلین،گلوکز اسیلین، دی گلوکزاسیلین، فلوگلوکز اسیلین)

 

ج-پنی سیلین های ضد سودوموناسی:

  • یوریدو پنی سیلین ها(مزولوسیلین و آزلوسیلین)
  • کربوکسی پنی سیلین ها(کاربنی سیلین و تیکارسیلین)
  • پیپرازین پنی سیلین ها(پیپراسیلین)

 

3-پنی سیلین های مهارکننده ی بتالاکتاماز:

  • آمپی سیلین-سولباکتام
  • تیکارسیلین-کلاوولونیک اسید
  • کوآموکسی کلاو(آموکسی سیلین+کلاوولونیک اسید)
  • پیپراسیلین-تازوباکتام (فرناندز و همکاران ، 2008).

 

 

2-9-6-2.کارباپنم ها:

این آنتی بیوتیک ها توسط استرپتومایسس کاتلیا تولید می شود و جزء مشتقات تینامایسین هستند. تینامایسین برای مصرف انسانی نیست، اما یکی از مشتقات فورمی میدول آن ایمی پنم نام دارد. کارباپنم شامل یک حلقه بتالاکتام پنج ضلعی می باشد بنابراین دارای ساختمان دو حلقه ای می باشد و وسیع الطیف ترین  آنتی بیوتیک بتالاکتامی است که در دسترس می باشد.

آنتی بیوتیک دیگری که خطر تشنج کمتری دارد مروپنم می باشد که نوعی کارباپنم است ولی طیف اثر آن شبیه ایمی پنم می باشد( پویرل و نوردمن ، 2006 ).

Fluit et al.

Medeiros, Jacoby

Fernandez et al.

Poirel, Nordman

موضوعات: بدون موضوع  لینک ثابت
 [ 08:38:00 ق.ظ ]




پنی سیلین های نیمه صنعتی:

الف-پنی سیلین های وسیع الطیف:

  • آمینو پنی سیلین(آمپی سیلین،آموکسی سیلین، بک آمپی سیلین)
  • آمید ینوسیلین(پیوی میسیلینام)

ب-پنی سیلین های مقاوم به پنی سیلیناز: نافیسیلین، متی سیلین، ایزوکسازیل                             پنی سیلین(اگزاسیلین،گلوکز اسیلین، دی گلوکزاسیلین، فلوگلوکز اسیلین)

 

ج-پنی سیلین های ضد سودوموناسی:

  • یوریدو پنی سیلین ها(مزولوسیلین و آزلوسیلین)
  • کربوکسی پنی سیلین ها(کاربنی سیلین و تیکارسیلین)
  • پیپرازین پنی سیلین ها(پیپراسیلین)

 

3-پنی سیلین های مهارکننده ی بتالاکتاماز:

  • آمپی سیلین-سولباکتام
  • تیکارسیلین-کلاوولونیک اسید
  • کوآموکسی کلاو(آموکسی سیلین+کلاوولونیک اسید)
  • پیپراسیلین-تازوباکتام (فرناندز و همکاران ، 2008).

 

 

2-9-6-2.کارباپنم ها:

این آنتی بیوتیک ها توسط استرپتومایسس کاتلیا تولید می شود و جزء مشتقات تینامایسین هستند. تینامایسین برای مصرف انسانی نیست، اما یکی از مشتقات فورمی میدول آن ایمی پنم نام دارد. کارباپنم شامل یک حلقه بتالاکتام پنج ضلعی می باشد بنابراین دارای ساختمان دو حلقه ای می باشد و وسیع الطیف ترین  آنتی بیوتیک بتالاکتامی است که در دسترس می باشد.

آنتی بیوتیک دیگری که خطر تشنج کمتری دارد مروپنم می باشد که نوعی کارباپنم است ولی طیف اثر آن شبیه ایمی پنم می باشد( پویرل و نوردمن ، 2006 ).

 

2-9-6-3.سفالوسپورین ها:

سفالوسپورین ها دارای حلقه بتالاکتامی به همراه حلقه ی دی هیدروتیازین بوده و جزء آنتی بیوتیک های بتالاکتامی محسوب می شود. این آنتی بیوتیک از کپک سفالوسپوریم آکرومونیوم به دست می آیند. سفامایسین ها (سفومیتام،سفمتازول،سفوکسیتین) مشابه سفالوسپورین ها بوده با این تفاوت که در حلقه ی دی هیدروکسی تیازین به جای گوگرد دارای اکسیژن بوده و در نتیجه نسبت به تجزیه ی بتالاکتامازی مقاوم تر می باشند.

انواع گوناگونی از سفالوسپورین ها تولید شده است که می توان آن ها را به چهارنسل تقسیم نمود که ترکیبات نسل اول این داروها معمولا فعالیت مناسب تری برابر باکتری های گرم مثبت دارند و نسل های بعدی آن ها در قبال باکتری های هوازی گرم منفی،فعالیت مناسب تر و بهتری دارند.

1-سفالوسپورین های نسل اول: سفالوتین، سفالکسین، سفاپیرین، سفادروکسیل، سفالوریدین، سفازولین، سفالکسین.

2-سفالوسپورین های نسل دوم: سفومایسین، سفوتتان، سفوکسیتین، سفوپروزیل، سفاکلر، سفامندول، سفورانید، سفونیاسید.

3-سفالوسپورین های نسل سوم: سفی کسیم، سفتازیدیم، سفوپرازون، سفونیر، سفوتاکسیم، سفتی زوکسیم، سفپودوکسیم، سفیبوتین، سفتریاکسون.

4-سفالوسپورین نسل چهارم: سفپرین، سفپیروم، سفی پیم( نیل و همکاران، 2006 )

 

 

2-9-6-4. مونوباکتام ها:

مونوباکتام فقط دارای یک حلقه می باشد و هسته مرکزی آن آمینوباکتامیک اسید است. آزترونام اولین آنتی بیوتیک مونوباکتام می باشد که بر خلاف ایمی پنم، آنتی بیوتیکی با طیف باریک است( پویریل و نوردمن ، 2006 ).

 

2-9-7.دیگر درمان های ترکیبی:

برای درمان ارگانیسم های گرم منفی که به چند دارو مقاوم هستند استفاده از داروهای ترکیبی بسیار مورد توجه واقع شده است. داروهای ترکیبی دو فایده عمده دارند:

1-باعث افزایش تاثیر گذاری شده.2-زمانی که فرد به یک دارو مقاومت نشان می دهد، مصرف داروهای ترکیبی مقاومت درمانی کمتری نشان می دهد.در مطالعات انجام شده معمولا درمان های ترکیبی با بهره گرفتن از سولباکتام ها و یا پلی میکسین ها انجام می گرفت که این دسته از داروها مهم ترین و قابل اطمینان ترین دسته از داروهای ضد میکروبی بودند.دیگر داروهای ترکیبی نیز ترکیبات متفاوتی از کینولون ها، بتالاکتام ها و آمیکاسین ها می باشد که با بهره گرفتن از تکنیک ها و مدل های حیوانی در شرایط آزمایشگاهی مورداستفاده قرار گرفتند(فالاگاس و بلیزیوتیس ، 2007)

 

Fernandez et al.

Poirel, Nordman

Neill et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:37:00 ق.ظ ]




مکانیسم عمل آنتی بیوتیک های بتالاکتام:

2-10-1.پنی سیلین ها:

پنی سیلین ها روی سنتز دیواره ی سلولی باکتریایی اثر می کنند و مانع رشد باکتری ها می شوند، دو مرحله ی اول سنتز دیواره ی سلولی یعنی تشکیل پنتاپپتید استیل مورامات و تبدیل آن به استیل گلوکز امین تغییر یافته و تشکیل پپتیدوگلیکان توسط پنی سیلین ها تحت تاثیر قرار نمی گیرد ولی در مرحله ی نهایی تشکیل دیواره ی سلولی، واکنش ترانس پپتیداسیون در سطح غشای سلول،توسط پنی سیلین ها مهار می شود که به دلیل شباهت ساختمانی D-آلانین-D-آلانین به پنی سیلین ها، این آنتی بیوتیک ها به ناحیه فعال آنزیم ترانس پپتیداز متصل می شوند. اگرچه آسیلاسیون آنزیم ترانس پپتیداز روی اثرات مهاری پنی سیلین ها و رشد باکتری اهمیت ویژه ای دارد، با وجود این، اهداف و پروتئین های دیگری در غشای سلول هستند که پنی سیلین ها به آن ها متصل می شوند. این اجزای غشاء پروتئین های با وزن مولکولی 120000-35000 به نام پروتئین های متصل شونده به پنی سیلین ها(PBPs) نامیده می شوند که اتصال به برخی از آنها با مرگ سلولی در ارتباط می باشد. این در حالی است اتصال به برخی دیگر از این پروتئین ها خواص مورفولوژیک باکتریایی را تغییر می دهد( فرناندز و همکاران ، 2003 ).

 

2-10-2.کارباپنم ها:

کارباپنم ها جزء آنتی بیوتیک های بتالاکتام محسوب می شوند که همانند همان گروه بیوسنتز دیواره ی سلولی را مهار می کنند. با این وجود بر خلاف دیگر بتالاکتام ها هدف های عمده ی کشنده ی آن ها در اشریشیاکلی PBP-1 و PBP-2 هستند. کارباپنم ها به دلیل اندازه ی کوچکی که دارند به خوبی به داخل باکتری های گرم منفی نفوذ می کنند. توانایی این داروها در مقابل پاتوژن های گرم منفی تولید کننده ی بتالاکتامازهای وسیع الطیف(ESBL)و یا مقدار بسیار بالایی از بتاکتاماز های AmpC، امتیاز عمده درمان این آنتی بیوتیک می باشد( سیروی و همکاران، 2005 )

 

2-10-3.سفالوسپورین ها:

سفالوسپورین ها، با اثر بر روی اجزای پپتیدوگلیکان دیواره سلولی باکتریایی، فعالیت ضد میکروبی خود را اعمال می کنند. پپتیدوگلیکان یک هتروپلی ساکارید مرکب از N-استیل گلوکز امین و N-استیل مورامیک اسید است که توسط پل های الیگوپپتیدی، پیوند عرضی با یکدیگر پیدا می کنند، در نتیجه یک ساختمان شبکه ای ایجاد می شود. پس از تشکیل اجزای دیواره در سیتوپلاسم و انتقال آن به سطح خارجی غشای سیتوپلاسمی، قند های جدید با اتصال عرضی از طریق عمل ترانس پپتیدازها، کربوکسی پپتیدازها و اندو پپتیداز ها به داخل ساختمان موجود ملحق می شوند. گروه آمیدی حلقه بتالاکتام ها در آنتی بیوتیک های بتالاکتام، از نظر شکل ساختمانی شبیه به باندD-آلانین-D-آلانین پنتا پپتید در پپتیدوگلیکان می باشد، لذا سبب می شود که آنزیم پپتیداز به اشتباه دارو را به عنوان سوبسترا بشناسد و زمانی که بدین ناحیه متصل شد فعالیت کاتالیتیک خود را از دست می دهد، چنین آنزیم هایی به عنوان PBPs شناخته می شوند. آرایش دقیق و تعداد PBPs در یک سلول در بین گونه ها متغییر می باشد. این آنزیم ها از نضر گرایش و اثرات ان ها روی بتالاکتام های مختلف با یکدیگر تفاوت دارند. غیر فعال شدن برخی از PBPs رشد دیواره ی سلولی را تغییر می دهد، این در حالی است که برخی دیگر، شکل سلول را تغییر می دهند. چگونگی مهار PBPs که سبب اثرات ضد میکروبی می گردد، هنوز به طور دقیق مشخص نشده است. حتی در یک ارگانیسم بیش از یک مکانیسم بر اساس این که کدام PBP به بتالاکتام متصل می شود، ممکن است وجود داشته باشد. علاوه بر این، عوامل بتالاکتام، اثرات باکتریوسیدالی خود را با رها کردن آنزیم های اتولیتیک در غشای سلول انجام می دهند ( نیل و همکاران ، 2006 ).

 

Extended-spectrum beta-lactamases

Siroy et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:35:00 ق.ظ ]




مکانیسم های مقاومت:

2-11-1.مکانیسم های مقاومت آنتی بیوتیکی:

آرایش گسترده مکانیسم های مقاومت ضد میکروبی که برای اسینتوباکتر بومانی گزارش شده است مشابه به دیگر پاتوژن های غیر تخمیری گرم منفی می باشد. مقاومت سریع سویه های اسینتوباکتر بومانی به تمام بتالاکتامازها نظیر کارباپنم ها، نشان دهنده ی پتانسیل این ارگانیسم در پاسخ سریع به تغییرات در فشار انتخابی می باشد.

تنظیم کردن مکانیسم های مقاومت ذاتی و اکتساب عوامل تعیین کننده ی خارجی مهارت های اساسی بود که اسینتوباکتر را به یک ارگانیسم با اهمیت تبدیل کرد. سویه های اسینتوباکتر بومانی در پتانسیل های اپیدمیولوژی شان تفاوت های زیادی دارند و آن سویه هایی که به صورت وسیع و سریعی بین بیمارستان ها گسترش می یابند به عنوان سویه های اپیدمیک اسینتوباکتر بومانی در نظر گرفته می شوند و در حقیقت مقاومت آنتی بیوتیکی یکی از علل گسترش بیمارستانی این سویه های باکتریایی می باشد. بعد از تعیین کردن سکانس یک سویه ی کلینیکی اپیدمیک اسینتوباکتر بومانی که در فرانسه یافت شده بود (AYE)، یک جزیره مقاومتی Kb 86 به نام AbaR1 یافت شد که یکی از بزرگترین جزایر ژنتیکی بود که تا کنون گزارش شده است. 88 ناحیه (ORFs) در این ناحیه ژنومیک قرار گرفته بود، 82 تای آنها از دیگر ارگانیسم های گرم منفی نظیر گونه های سودوموناس، سالمونلا منشا می گرفتند. در همین حین 52 ژن مقاومت نیز شناسایی شد که 45 ژن یعنی 5/86% در جزایر مقاومت AbaR1 واقع شده بود. محدوده ژنتیکی این عوامل مقاومت شامل عناصر ژنتیکی متحرک نظیر 3 کلاس از اینتگرون ها، ترانسپوزون ها و عناصر الحاقی (IS) می باشد که به صورت بسیار شگفت انگیزی هیچ یک از مارکر های پلاسمیدی در این نقاط مقاومت شناسایی نشد و از 3 پلاسمیدی که در نژاد AYE در فرانسه یافت شد هیچ کدام هیچ یک از مارکرهای شناخته شده ی مقاومت را دارا نبودند

( فورنیر، 2006 ).

 

 

 

2-11-2.مکانیسم های مقاومت به بتالاکتام ها:

ایجاد جهش در ژن های کروموزومی یکی از دلایل مقاومت اکتسابی باکتری ها به آنتی بیوتیک های بتالاکتام می باشد. عموما تغییرات وابسته به کروموزم در حساسیت به آنتی بیوتیک های بتالاکتام شامل تغییر در نفوذ پذیری آنتی بیوتیک یا تغییر در توانایی PBP ها برای شناسایی آنتی بیوتیک ها می باشد، اما بعضی از بتالاکتامازها توسط کروموزم کد می شوند( مدیروس و جکوبی ، 1986 ).

مکانیسم مقاومت به بتالاکتام ها می تواند شامل انواع آنزیمی و غیرآنزیمی باشد:

 

2-11-2-1. مکانیسم های آنزیمی:

بتالاکتامازها جزء پر دردسرترین مکانیسم های مقاومت به آنتی بیوتیک ها هستند. بتالاکتاماز در واقع یک نوع آنزیم است که به صورت غیر کووالانت به آنتی بیوتیک های بتالاکتام باند می شود و با تشکیل یک پیوند کووالانت سبب هیدرولیز باند آمیدی حلقوی حلقه لاکتام و آزاد شدن آنتی بیوتیک تغییر یافته می گردد. بتالاکتاماز ها برای آنتی بیوتیک های بتالاکتام، با PBP ها رقابت می کنند. امروزه بیش از 340 نوع بتالاکتاماز شناخته شده است که آن هایی که فعالیت کارباپنمازی دارند از جمله KPC و فعالیت متالوبتالاکتامازی دارند از جمله blaVIM و blaNDM به دلیل شیوع روز افزون آن ها بیشتر مورد توجه واقع شده است.

 

2-11-2-2.مکانیسم های غیر آنزیمی:

مقاومت به کارباپنم که نوعی مقاومت بتالاکتامی محسوب می شود توسط مکانیسم های غیر آنزیمی مانند تغییرات در پروتئین های غشای خارجی(OMPs) که سبب تغییر در نفوذپذیری باکتری ها نسبت به بتالاکتام ها می شود، صورت می گیرد، که ممکن است در اثر تغییر در پورین ها یا تغییر در لیپوپلی ساکاریدهای غشاء خارجی کاهش یابد. در باکتری های گرم منفی پورین ها و لیپوپلی ساکاریدها در قسمت خارجی غشاء قرار دارند و همین امر باعث می شود غشاء باکتری بصورت غیر قرینه باشد. درباکتری هایی که نسبت به بتالاکتام ها تحمل پیدا کرده اند، آنتی بیوتیک های بتالاکتام نمی توانند آنزیم های اتولیتیک القاء کنند. این بدان معنی است که پنی سیلین یا سفالوسپورین بیش تر از این که باکتریوساید باشد، باکتریواستاتیک است مگر این که میزان بسیار زیادی آنتی بیوتیک مصرف شود( سیروی و کاستی ، 2006 ).

مقاومت به ایمی پنم و مروپنم در اسینتوباکتر بومانی به دلیل از دست دادن یک پروتئین 29 کیلودالتونی به نامCarO است که این پروتئین جزء OMP ها می باشد. پروتئین های شوک حرارتی (HMP-AB) جزء پروتئین های غشای خارجی هستند که در ارتباط با مقاومت به بتالاکتام ها می باشند که با پروتئین های OmpA در انتروباکتریاسه ها و OmpF در سودوموناس آئروژینوزا مشابه می باشد.

شیوع کلینیکی مقاومت نسبت به کارباپنم ها در اسینتوباکتر بومانی به دلیل کاهش بیان پروتئین های 22 و 23 کیلودالتونی غشای خارجی در ارتباط با OXA-24 در اسپانیا و همچنین کاهش بیان پروتئین های 44 و 47 کیلودالتونی غشاء خارجی در اسینتوباکتر بومانی در شهر نیویورک می باشد( ویلا و همکاران، 2007 ).

پمپ های AdeABC که از خانواده پمپ های RND ها هستند، سوبستراهایی دارند که این سوبستراها شامل بتالاکتامازها، اریترومایسین، تتراسایکلین، آمینوگلیکوزیدها، کلرامفنیکل، تری متوپریم ها و فلوروکینولون ها می باشند( فورنیر، 2006).AdeABC  ها توسط کرومزوم ها کد و به صورت نرمال توسط یک سیستم دو جزئی با یک حسگر کیناز(AdeS) تنظیم می شود که این پمپ ها در ارتباط با AdeR که پاسخ دهنده تنظیمی است  می باشند. پمپ های AdeABC دارای سه جزء ساختمانی هستند.AdeB که باعث انتقال، AdeA باعث شکل دادن به پروتئین الحاق شده به غشاء درونی و AdeC، باعث شکل دادن به پروتئین های غشای خارجی می شود.

اگر ژن adeC که پرونئین های غشای خارجی را کد می کند غیر فعال شود پمپ AdeABC ممکن است با جایگزین کردن دیگر پروتئین های غشای خارجی بتواند فعالیت مجدد کمپلکس سه تایی را شکل دهد( پیوله و همکاران، 2004 ).

Fournier

Medeiros, Jacoby

Vila et al.

Piolle et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:34:00 ق.ظ ]




طبقه بندی بتالاکتامازها:

تولید بتالاکتاماز ها، مهم ترین مکانیسم مقاومت و بزرگ ترین سیستم دفاعی نسبت به آنتی بیوتیک های بتالاکتام در باکتری های گرم منفی می باشند و جزء آنزیم های هیدرولیتیکی به حساب می آید که قادرند حلقه بتالاکتام آنتی بیوتیک های بتالاکتامی را هیدرولیز کنند.

برخی از بتالاکتامازها در جایگاه فعال آنزیمی خود حاوی سرین و برخی همچون متالوبتالاکتامازها حاوی یون روی به عنوان کوفاکتور می باشند. بتالاکتامازها به وسیله ی ژن های واقع شده بر روی پلاسمیدها، ترانسپوزون ها و کرومزوم باکتریایی کد می شوند. بتالاکتامازهای کروموزومی می تواند به طور القایی و یا به طور ساختمانی بیان شوند و زمانی که این ژن ها در باکتری های گرم منفی بر روی پلاسمیدها یافت شوند، این آنزیم ها به طور ساختمانی بیان می شوند.

دانلود تحقیق و پایان نامه

در سال 1973 بتالاکتامازها توسط سیکو و ریچموند بر اساس خواص فنوتیپیک مثل وزن مولکولی، حساسیت به مهار کننده ها، طرح سوبسترا، شباهت ایمونولوژیک و ایزوالکتریک فوکوسینگ آن ها طبقه بندی و بر این اساس به پنج گروه تقسیم بندی شده اند

در سال 1976 این آنزیم ها توسط سایکس و ماتیو مجددا طبقه بندی شدند و سپس در سال 1980 توسط آمبلر و همکارانش بر اساس یک توالی motif، متمایز به چهار کلاس مولکولی متفاوت از نظر تکاملی(A،B،C،D) تقسیم بندی شده اند که آنزیم های کلاس A و Cشایع تر هستند و در محل فعال آنزیم در ریشه اصلی کاتالیتیک دارای سرین همچون کلاس D می باشند و کلاس B شامل متالوبتالاکتامازها        می باشد( لاندمن و همکاران، 2002

بتالاکتامازهای باکتری های گرم منفی:

باکتری های گرم منفی با تولید آنزیم های بتالاکتامازی بهترین مقاومت را انجام می دهند و انواع متنوعی از آنزیم ها در گونه های مختلف تولید می شود و ژن های کد کننده آن ها کروموزومی یا پلاسمیدی می باشند، مثلا در هموفیلوس آنفولونزا، نایسریا گونوره آ، انتروباکتریاسه، ویبریوکلرا، موراکسلا کاتارالیس و اسینتوباکترها تولید این آنزیم های بتالاکتامازی شایع می باشد. بتالاکتامازهای تولیدی، متصل به سلول هستند و در فضای پری پلاسمی تجمع می یابند و تولید آن ها در گرم منفی ها دائمی و همیشگی است( کاستا و همکاران، 2000).

 

2-14.بتالاکتامازهای باکتری های گرم مثبت:

از مهم ترین مکانیسم های دفاعی در باکتری های هوازی و بی هوازی گرم مثبت می توان به تولید بتالاکتامازها اشاره کرد مثلا در استافیلوکوکوس اورئوس که مولد بتالاکتاماز القایی اند و قادر به هیدرولیز سفالوسپورین می باشند، از طرفی این باکتری با توالی پنی سیلیناز به پنی سیلین مقاوم است.

مایکوباکتریوم توبرکلوزیس با تولید blaC کد شده توسط کروموزوم، آنتی بیوتیک های بتالاکتامی را هیدرولیز می کند و همچنین باسیلوس آنتراسیس و باسیلوس سرئوس با تولید bla-1 و bla-2 به آمپی سیلین و پیپراسیلین مقاوم می باشند.

 

2-15.بتالاکتامازهای وسیع الطیف:

ESBL ها بتالاکتامازهای دسته ی مولکولی A هستند که قابل انتقال از یک سویه به سویه دیگر و یا مابین گونه های باکتریایی می باشند. تعداد اندکی از ESBL ها هم در زیر گروه 2be و 2d قرار میگیرند.

شیوع بتالاکتامازها در ارگانیسم ها زمانی شروع شد که آنتی بیوتیک های بتالاکتامی به منظور استفاده های پزشکی به کار رفتند. به طوری که حتی آنزیم هایی شناخته شده اند که شایع نیستند و در پاتوژن هایی که فاقد بتالاکتاماز بوده اند امروزه دیده می شود . باکتری های تولید کننده ESBL نسبت به 7-α-متوکسی سفالوسپورین ها(سفامایسین ها) و کارباپنم ها(مروپنم، ارتاپنم و ایمی پنم) حساس باقی می مانند، اغلب این باکتری ها مقاومت به آنتی بیوتیک های دیگر را نشان  می دهند که یک بحران در امر درمان را به وجود       می آورند.

Landman et al.

Costa et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:33:00 ق.ظ ]




ESBL ها دارای خصوصیات زیر می باشند:

1.یک ناحیه فعال سرینی دارند.

2.عموما به وسیله ی مهار کنندگان بتالاکتاماز مثل کلاوولانیک اسید، سولباکتام و تازوباکتام مهار می گردند.

3.قادر به هیدرولیز اکسی ایمینوسفالوسپورین ها (سفتازیدیم، سفوتاکسیم و سفتریاکسون)هستند. میزان هیدرولیز آن ها در حدی برابر با هیدرولیز بنزیل پنی سیلین ها و یا 10% بیش از آن ها می باشد( استورنبورگ و مک، 2003 ).

 

2-16.خصوصیات آنتی بیوتیک های وسیع الطیف:

ESBL های کلاسیک از فامیل آنزیم های کد شونده توسط پلاسمید TEM، SHV،  OXAتوسعه یافته اند، ولی توسعه انفجاری ESBL های غیر TEM، غیر SHV،غیر OXA در سال های اخیر مثل خانواده های آنزیمی NDM، VIMدر سرتاسر دنیا گسترش یافته و تکامل ESBLها بسیار سریع صورت گرفته است( ژورگ، 2005 ).

 

2-17.حساسیت ESBL ها در مقابل آنتی بیوتیک ها:

ESBL ها با آنزیم های والد خود، با جانشینی 1 تا 7 آمینواسید تفاوت دارند که این جانشینی شکل خاص ناحیه فعال این آنزیم ها را تغییر می دهد موتاسیون حاصله با وسیع تر نمودن ناحیه فعال، فضای کافی برای واکنش متقابل آنزیم با بتالاکتام های حاوی توده زنجیره ی جانبی اکسی ایمینو را ایجاد می کند، در نتیجه ESBL ها بر خلاف آنزیم های والد خودشان، بتالاکتام های طیف گسترده را به عنوان سوبسترای خود تشخیص می دهند، توانایی هیدرولیز آنتی بیوتیک های بتالاکتام حاوی گروه اکسی ایمینو(سفتازیدیم، سفوتاکسیم، آزترونام و سفوروکسیم) را در حدی حداقل بیش از 10% از آن چه که برای بنزیل پنی سیلین ها مشاهده شده را دارند. با وجود این، جانشینی در موقعیت مختلف آمینواسیدی به ESBL ها اجازه نمی دهد که ضرورتا سوبستراهای یکسان را هیدرولیز نمایند. اگرچه اغلب موتاسیون های تیپESBL در مقایسه با آنزیم های والد فعالیت بتالاکتامازی کلی را کاهش می دهد، سویه هایی با آنزیم ESBL به طور پایداری به آمینو  پنی سیلین ها، کربوکسی پنی سیلین ها، یوریدو پنی سیلین ها مقاوم هستند و در مقابل پنی سیلین ها این سویه ها تنها در آزمایشگاه در برابر Temocillin حساس هستند. خوشبختانه به جزء چند استثناء در مقابل سفامایسین ها و کارباپنم ها ESBL ها فعال نیستند.در حالی که گزارش شده است که ارگانیسم های تولید کننده ی ESBL ها می توانند به سبب تغییرات در سطح غشاء خارجی نسبت به سفامایسین ها مقاوم گردند   ( سیروت و همکاران، 1997 ).

 

2-18.انواعESBL  ها:

2-18-1.بتالاکتامازهای تیپ SHV :

این آنزیم ها به زیر گروه های 2b، 2be، 2brتعلق دارند. تاکنون بیش از 127 آنزیم ESBL تیپ SHVگزارش شده است که SHV-5 و SHV-12در میان اعضای این خانواده بیش تر شایع                   می باشد.ESBL های تیپ SHV و TEM در جایگاه فعال خود جانشینی آمینواسیدی دارند که به یک یا بیشتر از یک جایگاه می توان اشاره کرد. پیش ساز دسته آنزیم های SHV،  SHV-1عموما در کلبسیلا پنومونیه یافت شده بود و در 86% اسیدآمینه هایش با TEM-1 مشترک می باشد و از نظر ساختاری شباهت کلی به هم دارند.SHV-1 مقاومت به پنی سیلین های وسیع الطیف را اعطاء می نماید در حالی که نسبت به اکسی ایمینو سفالوسپورین ها این مقاومت را ایجاد نمی کند.

ژن بتالاکتاماز SHV-1 به عنوان یک ژن کروموزومی در کلبسیلا ظاهر شده است و بعد با پلاسمید ادغام شده که از آن طریق به گونه های دیگر انتروباکتریاسیه پخش شده است.ESBL های تیپ SHV اخیرا در مطالعات ایزوله های کلینیکی مقاوم در اروپا و امریکا غالب شده اند( راندگر و همکاران، 2000 ).

 

2-18-2.بتالاکتامازهای تیپ TEM:

این آنزیم ها به زیرگروه های 2b، 2be،2br،2bc تعلق دارند و تعداد آن ها 172 عدد می باشد و اولین بار از کشت خون یک بیمار یونانی به نام تمونیرا، اشریشیاکلی که حاوی این آنزیم بود گزارش شد و پس از چند سال بتالاکتامازهای TEM-1 در سرتاسر جهان گسترش یافت و امروزه معمول ترین مکانیسم مقاومت باسیل های گرم منفی در برابر با آنتی بیوتیک های بتالاکتام را به خود اختصاص می دهند.جانشینی آمینواسیدی در مکان های زیادی در آزمایشگاه می تواند بتالاکتامازهای TEM-1 را بدون از دست دادن فعالیت ایجاد کند که آن ها مسئول ایجاد تغییرات فنوتیپی ESBL در جایگاه فعال آنزیمی هستند که امکان دسترسی به       اکسی ایمینوها را فراهم می کنند. دهانه ی جایگاه فعال به سوبسترای بتالاکتام، حساسیت به آنزیم های مهارکننده ی بتالاکتامازی همچون کلاوولانیک اسید را افزایش می دهد( سیروت و همکاران ، 1997 ).

 

2-18-3.بتالاکتامازهای تیپ OXA:

این آنزیم ها به زیر گروه های2d ، 2de،  2dfبوش تعلق دارند و تعداد آن ها 158 آنزیم می باشد. سویه اسینتوباکتر بومانی در سال 1985 جدا شد که در آن زمان به ایمی پنم حساس بود.در سال 1993 اولین گروه از بتالاکتامازهای OXA با طیف اثر محدود در سویه های اسینتوباکتر بومانی مقاوم به ایمی پنم در انگلستان رویت شدند که دارای فعالیت هیدرولیز کننده ی کارباپنمی بودند و نکته مهم این است که این مقاومت قابل انتقال می باشد. بین سال های 2000 تا 2004 شش آنزیم OXA-type در سویه های مقاوم به کارباپنم جمع آوری شد ( برون و آمیس، 2006 ).

Sturenburg,Mack

George

Sirot et al.

Randegger et al.

Brown, Amyes

موضوعات: بدون موضوع  لینک ثابت
 [ 08:31:00 ق.ظ ]




بتالاکتامازهای تیپCTX-M :

این آنزیم ها به زیر گروه 2be در طبقه بندی بوش تعلق دارند.از سال 1995 به بعد میزان انتشار آن ها در میان باکتری ها و اغلب قسمت های دنیا به طور قابل ملاحظه ای افزایش یافته است، به طوری که شایع ترین گروه ESBL ها می باشند و شامل 90 آنزیم هستند.

تحقیق - متن کامل - پایان نامه

 

2-18-5. بتالاکتامازهای تیپ NDM(متالوبتالاکتاماز):

blaNDM یک متالوبتالاکتاماز کلاس B آمبلر و 3 بوش می باشد، این آنزیم وابسته به روی است و به همین دلیل به عنوان متالوبتالاکتاماز نامیده می شود، که باعث هیدرولیز تمام آنتی بیوتیک های بتالاکتامی به جز آزترونام می شود و به طور گسترده ای به آنتی بیوتیک ها مقاوم می باشد و تنها به کلی ستین و به میزان کمتر به تایگلسین حساس می باشد.

blaNDM برای اولین بار در سال 2008 از بیمار سوئدی هندی تبار از کلبسیلا پنومونیه جداسازی شد، بعد از آن در ایزوله های موجود در هند، انگلستان، ژاپن، پاکستان، کانادا، ایالات متحده گزارش داده شد. در ماه آگوست 2010 اولین مرگ ناشی از بیان ژن blaNDM در یک مرد بلژیکی رخ داد. او در یک تصادف اتومبیل در طول سفر به پاکستان و به دنبال آن آسیب عمیق به پای او، در یک بیمارستان در پاکستان بستری شده و سپس به بلژیک بازگردانیده شد و در حالی که با کلی ستین درمان صورت گرفته بود اما بیمار به علت عفونت زیاد در گذشت. بر اساس ویژگی عملکردی دارای خاصیت هیدرولیز ایمی پنم، حساسیت بهEDTA، عدم مهار توسط مهارکنندگان بتالاکتامازهای سرینی می باشند.

پخش و گسترش آنزیم های blaNDM در میان گونه های مختلف باکتریایی ناشی از قرار گیری ژن های blaNDM بر روی پلاسمید های میزبانی انتقال پذیر و ارتباط شان با ترانس پوزون ها و عناصر IS می باشد.

تشخیص ژن blaNDM به تعیین فنوتیپی فعالیت آنزیم بستگی دارد. امروزه تست های اصلاح شده ی Hodge-Test که به تازگی توسعه یافته است برای تشخیص معمول این آنزیم در آزمایشگاه کاربرد دارد( یان و همکاران، 2011 ).

 

2-18-6.بتالاکتامازهای تیپ VIM(متالوبتالاکتاماز):

blaVIM یک متالوبتالاکتاماز کلاس B آمبلر و 3 بوش می باشد،این آنزیم به کاتیون های دو ظرفیتی مانند فلز روی به عنوان کوفاکتور برای فعالیت آنزیمی خود نیاز دارند. ژن های کدکننده این آنزیم ها بر روی عناصر متحرک(پلاسمید)قرار دارند که به راحتی می توانند به سایر باکتری ها متصل شوند. اولین سویه ی حاوی ژن blaVIM نیز در ایتالیا در سال 1997 مشاهده شد.

متالوبتالاکتامازها توسط کلاوولانیک اسید و سولباکتام و تازوباکتام که بازدارنده بتالاکتامازها هستند، مهار نمی شوند.بازدارنده های متالوبتالاکتامازها در محیط آزمایشگاه، شامل دی آمین تترا استیک اسید، سدیم مرکاپتواستیک اسید، 2مرکاپتوپروپیونیک اسید و دی پیکولینیک اسید هستند.

 

2-19. فاکتور هایی که بر بیان بتالاکتامازها اثر می گذارند:

یکی از این فاکتورها جذب بتالاکتام ها است که باعث کاهش بیان پورین های غشای خارجی می شود. در کلبسیلا پنومونیه کاهش بیان پورین های غشای خارجی اغلب همراه با تولید ESBLها است که ممکن است به ESBLها اجازه دهد که مقاومت به سفی پیم را بیان کنند، یا مثلا در تعدادی از ارگانیسم ها مخصوصا سودوموناس آئروژینوزا یک سیستم فعال Efflux می تواند انباشتگی آنتی بیوتیکی درون سلولی خود را کاهش دهد در برابر آنزیم ها اجازه دهد که ظرفیت هیدرولیتکی محدودی داشته باشند تا بتوانند دارو را قبل از اینکه به هدف خود برسد غیر فعال کنند( ژورگ ، 2005 ).

 

2-20.درمان عفونت های ایجاد شده توسط سویه های مولد ESBL:

طی تحقیقات انجام شده،گزارش شده که آنتی بیوتیک های مخصوصی که به صورت ترکیبی با هم تجویز می گردند در درمان موثر می باشند. به عنوان مثل به منظور درمان عفونت هایی که مسبب آن گونه های اشریشیاکلی و کلبسیلای مولد  ESBLمی باشند ایمی پنم و مروپنم بیش ترین کاربرد را دارند و سفی پیم و پیپراسیلین-تازوباکتام کمتر موفقیت آمیز می باشند و سفتریاکسون، سفتازیدیم و سفوتاکسیم نیز دیگر کاربرد ندارند با این که در آزمایشگاه هنوز باکتری ها به آن ها حساس می باشند.

در آزمایشگاه ارگانیسم های مولد ESBLهای تیپ TEMو SHV سفی پیم و پیپراسیلین-تازوباکتام حساس هستند اما با تلقیح هر دو دارو میزان حساسیت بدان ها کاهش می یابد.ارگانیسم های مولد ESBLهای تیپ CTX-Mو OXA در آزمایشگاه با وجود مصرف مقدار استانداردی از تلقیح به سفی پیم مقاوم اند.

از طرفی هم مقاومت به آنتی بیوتیک های غیر بتالاکتامی در سویه هایی که مولد آن آنزیم های بتالاکتامازی هستند نیز شایع می باشد پس باید تست حساسیت مستقیم برای درمان صورت بگیرد. مقاومت نسبت به فلوروکینولون ها و آمینوگلیکوزیدها نیز بالا می باشد( جکوبی و همکاران، 1997 ).

مطالعات اندکی پیرامون یافتن طرح درمانی مناسب برای عفونت های ایجاد شده توسط سویه های سودوموناس آئروژینوزا مولد ESBL انجام شده است که نتایج آن ها تجویز ترکیبی بتالاکتام ها همراه کینولون ها یا آمینوگلیکوزید ها می باشد.

گزارشاتی هم حاکی از آن است که استفاده از سفامایسین در نتیجه ی فقدان پورین با شکست روبرو شده است. بعضی از بیماران به درمان با آمینوگلیکوزیدها یا کینولون ها جواب می دهند، اما در مقایسه ای که اخیرا صورت گرفته است در کلبسیلا پنومونیه های مولد ESBL که مسبب باکتریمی می شوند ایمی پنم نسبت به سیپروفلوکساسین بهتر اثر می گذارد.

ارگانیسم هایی هم که فقط مولد ESBL هستند در آزمایشگاه به سفامایسین ها و کارباپنم ها حساس هستند و در صورت تلقیح به این ها اثرات کمی را نشان می دهند. ارگانیسم های مولد متالوبتالاکتاماز تیپNDM  به کلی ستین و به میزان کمتر به تایگلیسین حساس هستند.

 

 

Yan et al.

Jacoby et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:30:00 ق.ظ ]




مثال هایی از مکانیسم های مقاومت به بتالاکتام ها:

2-22-1.مکانیسم مقاومت به کارباپنم ها:

از مهم ترین آنزیم های هیدرولیز کننده ی کارباپنم ها می توان به انواع زیادی از بتالاکتامازها اشاره کرد که متالوبتالاکتامازها جزء مهم ترین هیدرولیز کننده های کارباپنم ها هستند که همه دارو های بتالاکتام را به جزء آزترونام هیدرولیز می نمایند و به مهار کنندگان بتالاکتاماز در دسترس مقاوم هستند و به عنوان یک کو فاکتور به روی نیازمند هستند. نگرانی اخیر ، وقوع و انتشار متالوبتالاکتامازهای وابسته به پلاسمید قابل انتقال می باشد.

این آنزیم ها ابتدا در سال 1990 گزارش شدند، از دست دادن پورین های اختصاصی کارباپنم ها oprD در غشاء خارجی همراه با بیان بسیار زیادAmpC مقاومت نسبت به ایمی پنم و مروپنم را سبب می شود.

به جزء بتالاکتامازها سه نوع مکانیسم مقاومت دیگر به کارباپنم ها را هم می توان نام برد که شامل:  هدف تغییر یافته، هیدرولیز دارو و کاهش تجمع دارو به دلیل

Active efflux and/or Dimimished penetration از عرض غشا ی خارجی باکتری های گرم منفی می باشند.

کارباپنم ها القا کنندگان قوی آنزیم های گروه 1 Bush و متالوبتالاکتامازهای کروموزمی StenotropHomonas maltopHilia وAeromonas hydropHila هستند.استفاده توام کارباپنم ها و آنتی بیوتیک های بتالاکتام دیگر، به دلیل این خصوصیت، باید جلوگیری نمود زیرا پدیده ی انتاگونیسم اتفاق می افتد ( پویرل و نوردمن ، 2006 ).

2-22-2.مکانیسم مقاومت به پنی سیلین ها:

هیدرولیز آنزیماتیک حلقه ی بتالاکتام توسط آنزیم بتالاکتاماز اولین مکانیسم مقاومت به پنی سیلین ها  می باشد.تولید بتالاکتامازها در گرم مثبت ها وابسته به  پلاسمید و قابل القا می باشد.در باسیل های گرم منفی بتالاکتامازها در فضای پری پلاسمی ما بین غشاء سلولی داخلی و خارجی واقع شده اند، مولکول های        پنی سیلین که از غشاء خارجی عبور می کنند می توانند قبل از رسیدن به محل عمل خود با بتالاکتاماز در تماس قرار گیرند. اگرچه، به نظر می رسد همه باکتری های گرم منفی حاوی آنزیم بتالاکتاماز باشند ولی به طور قابل توجهی تیپ و مقدار این آنزیم ها در باکتری ها با هم تفاوت دارند.

در باسیل های گرم مثبت ارگانیسم ها زمانی که در معرض پنی سیلین ها قرار گرفتند مقدار بسیار زیادی از آنزیم را به محیط اطراف خود می ریزند تا همه دارویی که در دسترس است را تخریب نمایند.

تولید بتالاکتامازها در گرم مثبت ها وابسته به پلاسمید و قابل القا می باشند ولی در باسیل های گرم منفی این آنزیم ها می توانند وابسته به کروموزم و یا پلاسمید، یا جزئی از ساختار باکتری و یا القایی باشند و فقط در مقابل دسته ی خاصی از داروهای بتالاکتام فعال باشند. با توجه به این که توانایی پنی سیلین ها در مهار رشد باسیل های گرم منفی به میزان نفوذ از عرض غشای خارجی آن ها بستگی دارد تغییر در زنجیره جانبی        پنی سیلین ها سبب فعالیت این داروها روی باکتری های گرم منفی می گردند که این عمل را عموما بیش از کاهش میزان هیدرولیز از طریق افزایش قدرت نفوذ از عرض غشای خارجی انجام می دهند. پنی سیلین ها به وسیله ی بتالاکتامازهای وسیع الطیف جدیدتر غیر فعال می شوند.

یک مکانیسم دیگر مقاومت به پنی سیلین ها که اهمیت فوق العاده ای یافته است، تغییر در ناحیه ی هدف می باشد، کاهش گرایش PBP ها به پنی سیلین ها، ناشی از جانشینی آمینواسید و جایگذاری آن ها در PBP ها حاصل می شود. تغییر در نفوذ پذیری غشای خارجی باسیل های گرم منفی یک مکانیسم دیگر مقاومت به پنی سیلین ها می باشد. موتانت هایی باکاهش پورین و با تغییر در پورین، 2 تا 16برابرMIC بالاتر را در مقابل پنی سیلین های وسیع الطیف نشان می دهد. بیان بیش از حد پمپ Efflux ، مثل MexAB-opr در سودوموناس آئروژینوزا، نیز سبب ایجاد مقاومت می گردد. با این وجود در اغلب نمونه های بالینی مقاوم، کاهش نفوذپذیری Efflux همراه با تغییر PBP ها و یا تولید بتالاکتاماز قابل القاء اتفاق می افتد (فرناندز و -همکاران ، 2003).

موضوعات: بدون موضوع  لینک ثابت
 [ 08:28:00 ق.ظ ]




مکانیسم مقاومت به مونوباکتام ها:

آزترونام با بتالاکتامازهای وابسته به پلاسمید بسیار شایع موجود در بسیاری از انتروباکتریاسه ها به سرعت هیدرولیز نمی شود. با وجود این آنزیم هایی وجود دارد که مقاومت نسبت به آزترونام را به باکتری اعطاء می نمایند مثلا ظهور تدریجی بتالاکتامازهای وسیع الطیف نوعی از طرح مقاومت می باشد که کارایی آزترونام را تهدید می کند.اغلب ESBL ها، مشتقات قدیمی تر آنزیم های کد شونده پلاسمیدی هستند که ناحیه فعال آن ها دچار موتاسیون شده و هیدرولیز آزترونام و سفالوسپورین های وسیع الطیف شبیه سفتازیدیم و سفوتاکسیم در آن ها افزایش یافته است. معمول ترین ESBL های شناخته شده،TEM ، VIM، NDM  هستند که ابتدا در کلبسیلا پنومونیه و اشریشیاکلی شناخته شدند.با وجود این، این آنزیم ها در دیگر جنس های انتروباکتریاسه و در سودوموناس آئروژینوزا، بورخولدریا سپاشیا، شناسایی شده اند. اگر چه بسیاری از انتروباکتریاسه ها و سودوموناس آئروژینوزا با آزترونام از بین می روند این باکتری ها مقادیر کم از سفالوسپورینازهای AmpC کروموزومی را تولید می کنند. تولید مقادیر زیاد آنزیم های AmpC در موتانت ها، مقاومت نسبت به آزترونام و اغلب بتالاکتام های دیگر را فراهم می سازد.موتانت های آزمایشگاهی با حساسیت کمتر نسبت به آزترونام، نیز شده اند که از طریق مکانیسم های غیر آنزیمی سبب مقاومت می گردند. اغلب در این موتانت ها کاهش نفوذپذیری نسبت به دارو نشان داده شده است ( راندگر و همکاران ، 2000 ).

 

2-22-4.مقاومت به آمینوگلیکوزیدها:

در گزارشی که از ژاپن، کره، آمریکا بر روی اسینتوباکتر بومانی سویه (armA) اعلام شد نشان داده شد که وجود متیلاسیون 16SrRNA باعث ایجاد یک مکانیسم مقاومتی شد، بدین صورت که باعث جفت کردن نواحی اتصال آمینوگلیکوزیدها با جایگاه هدف خودش می شود در نتیجه مقاومت بسیار بالایی به تمام آمینوگلیکوزیدهایی که از نظر کلینیکی مفید بودند نظیر جنتامایسین، توبرامایسین، آمیکاسین نشان می داد.ژن armA توسط پلاسمید انتقال می یابد و داخل ترانسپوزون قرار دارد.

AbeM جزئی از خانواده پمپ های MATE می باشد و آمینوگلیکوزیدها سوبستراهایی برای پمپ AbeM می باشند ( مگنت و همکاران، 2001 ).

 

 

 

2-22-5. مقاومت به پلی میکسین ها:

در گذشته نشان داده شد که مقاومت نسبت به اشریشیاکلی، سالمونلا و سودوموناس آئروژینوزا به دلیل کاهش در جایگاه اتصال لیپوپلی ساکاریدها می باشد که باعث ایجاد مقاومت می شود. هم چنین تغییراتی که در پروتئین های غشای خارجی(OMPs) ایجاد شد باعث کاهش حساسیت نسبت به پلی میکسین ها می شد که در مورد سودوموناس آئروژینوزا گزارش شد. امروزه مقاومت اسینتوباکتر بومانی نسبت به پلی میکسین ها در شرایط in vitro گزارش شده اما مکانیسم های این مقاومت هنوز ناشناخته باقی مانده است(بنیفلا و- همکاران، 2004 ).

 

2-22-6.مقاومت به کینولون ها:

تغییراتی در DNA gyrase و یا توپوایزومراز IV طی موتاسیونی که در ژن های gyrA و parC که برای اسینتوباکتر بومانی شرح داده شد ایجاد شد که این موتاسیون باعث دخالت در جایگاه های اتصال هدف می شدند. مشابه آمینوگلیکوزیدها، بسیاری از کینولون ها سوبسترای پمپ های انتشار به خارج چندین دارو، نظیر پمپ های AdeABC که از نوع پمپ های RND و پمپ های AdeM که متعلق به پمپ های خانواده MATE هستند، بودند. هم چنین مقاومت های کینولونی که مرتبط با پلاسمید بود مربوط به ژن qnr بود که تاکنون در مورد اسینتوباکتر بومانی گزارش نشده است ( میلاتوویک و همکاران، 2000 ).

 

2-22-7.مقاومت به تتراسایکلین ها و تایگلسین ها:

مقاومت به تتراسایکلین ها و مشتقات آن ها مرتبط به پمپ ها و یا حفاظت ریبوزومی بود. پمپ های اختصاصی انتشار به خارج تتراسایکلین شامل آن هایی بود که توسط ژن های tet(A) تا tet(E) کد می شد که معمولا در ارگانیسم های گرم منفی یافت می شود.tet(A)  و tet(B) برای اسینتوباکتر بومانی شرح داده شد که tet(A) در یک ترانسپوزون مشابه با Tn1721 یافت شد و در ارتباط با عناصر IS بود.

tet(A) باعث ایجاد مقاومت نسبت به تتراسایکلین می شد ولی بر علیه مینوسایکلین ها که داروی قوی تری برای اسینتوباکتر بومانی می باشد به کار نمی آید. جدا از پمپ های اختصاصی انتشار به خارج تتراسایکلین، این کلاس از داروهای ضد میکروبی هم چنین نسبت به پمپ های انتشار به خارج چندین دارو نظیر پمپ AdeABC نیز حساس بودند. تایگلیسین که اولین داروی ضد میکروبی از کلاس تغییر یافته ی تتراسایکلین ها بود و به نام گلیسیل سایکلین شناخته شده بود نیز سوبستراهایی برای انتشار به خارج بود. با انجام دادن Real Time PCR بر روی ژن adeB، با افزایش MICs تایگلیسین، افزایش بیان adeB مشاهده شد.

نقش پمپ AdeABC در کاهش حساسیت به تایگلیسین توسط غیر فعال شدن ساختن ژن adeB مشخص شد که منجر به کاهش MIC تایگلیسین از 4 میکروگرم بر میلی لیتر به 5/0 میکروگرم بر میلی لیتر شد( فلویت و همکاران، 2005 ).

 

Magnet et al.

Benifla et al.

Milatovic et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:27:00 ق.ظ ]




مهارکنندگان بتالاکتامازها:

اولین مهار کننده بتالاکتاماز اسید کلاوولانیک می باشد،این آنتی بیوتیک از جهاتی با پنی سیلین ها تفاوت دارد که وجود اتم اکسیژن به جای اتم سولفور، عدم وجود زنجیره جانبی روی حلقه ی بتالاکتام و جانشینی Hydroxyethylidene روی حلقه اگزازولیدین از جمله تفاوت این عامل با پنی سیلین ها می باشند.

سه ترکیب سولفون های نیمه سنتیک اسید، سولباکتام و تازوباکتام دارای فعالیت ضد میکروبی بوده و جزء مهارکنندگان محسوب می شوند.

یک مهار کننده بتالاکتاماز در ترکیب با آموکسی سیلین، تیکارسیلین، آمپی سیلین و پیپراسیلین، فعالیت آن دارو را در مقابل سویه های تولید کننده بتالاکتاماز، هموفیلوس آنفلونزا، گونوکوک ها، موراکسلا کاتارالیس، گونه های کلبسیلا، استافیلوکوکوس و اشریشیاکلی افزایش می دهد. در حالی که فعالیت آن در مقابل دیگر باسیل های گرم منفی، به طور وسیعی توسط مهارکنندگان بتالاکتاماز بدون تغییر می ماند( برایورس و همکاران، 2005 ).

 

2-23-1.مکانیسم عمل مهارکنندگان بتالاکتامازها:

تازوباکتام به PBP1 و یا  PBP2متصل شده و به تنهایی فعالیت ضد باکتریایی بسیار ضعیفی را دارد. تازوباکتام به عنوان یک Suicidal Beta-lactamase Inhibitor عمل می کند. تازوباکتام، فعالیت خوبی در مقابل بتالاکتامازهای پلاسمیدی دارد ولی در مقابل بتالاکتامازهای کروموزومی قابل القاء انتروباکتریاسه ها فعالیت ضعیفی دارد.

اسید کلاوولانیک به وسیله تشکیل یک کمپلکس آسیل-آنزیم با بتالاکتاماز به عنوان Suicide Inhibitor عمل می کند که به کاهش فعالیت آنزیم بتالاکتاماز منجر می گردد.

بتالاکتامازهای TEM وابسته به پلاسمید در سویه های مقاوم به سفتازیدیم در کلبسیلا پنومونیه و اشریشیاکلی با این عامل غیر فعال می شوند، در حالی که بتالاکتامازهای قابل القاء(کلاس یک کروموزمی) در انتروباکتر، سراشیا، سیتروباکتر و سویه های سودوموناس با کلاوولانیک اسید مهار نمی شوند.

در بسیاری از باکتری ها، سولباکتام به عنوان یک مهار کننده موثر بتالاکتامازهای وابسته به پلاسمید و کروموزومی می باشد. این دارو در مقابل ارگانیسم هایی که به دلیل تولید بتالاکتاماز در مقابل بتالاکتام ها مقاوم می باشند، به طور سینرژیک با پنی سیلین ها و سفالوسپورین ها عمل   می کند( ولف و همکاران، 2000 ).

 

2-24.روش های شناسایی آنزیم های ESBL:

2-24-1-1.آزمایش مجاورت دو دیسک:

روش مجاورت دو دیسک(DDT) یک روش در تایید تولید ESBL می باشد. در این روش ارگانیسم مورد آزمایش، روی محیط کشت مولر هینتون آگار پخش می شود و یک دیسک حاوی آموکسی سیلین/کلاوولانات gμ10/gμ20 در وسط پلیت قرار داده می شود و دیسک های حاویgμ30 از سفتازیدیم، آزترونام، سفتریاکسون، سفوتاکسیم و یا سفودوکسیمgμ10 به فاصله ی 25 تا 30 میلی متری از آن قرار داده  می شود. افزایش و یا نامنظمی هاله ی مهار رشد ما بین دیسک سفالوسپورین ها و دیسک حاوی کلاوولانات نشان دهنده وجود ESBL می باشد. این روش، اولین تست بیان شده توسط Jarlier و همکارانش در شناسایی این آنزیم ها می باشد.این روش معمول بوده و انجام آن آسان و مقرون به صرفه می باشد ولی عیب این روش آن است که اگر تلقیح باکتری خیلی زیاد باشد و یا اگر دیسک ها خیلی دور از هم قرار داده شوند سینرژیسمی مابین دیسک آموکسی سیلین/کلاوولانات و سفالوسپورین به طور غیر عمده نادیده گرفته می شود، لذا برخی از محققین فاصله لبه به لبه mm15 بین دیسک ها را مطرح کرده اند که در این صورت حساسیت آزمایش خیلی بیش از زمانی است که فاصله بین دیسک ها 35-25 میلی متر در نظر گرفته شود( پویرل و همکاران ، 2007 ).

 

Brauers et al.

Wolff et al.

Double Disk approximation Test

در اسینتوباکتربومانی های ایزوله شده از بیماران شهرتهران

موضوعات: بدون موضوع  لینک ثابت
 [ 08:25:00 ق.ظ ]




ترکیب دو دیسک:

جهت تایید آزمایش های غربالگری باکتری های تولید کننده ی آنزیم های بتالاکتاماز، CLSI در سال 1999 راهنمایی های لازم را ارائه داد. در یک تحقیق، باکتری همانند آزمایش مجاورت دو دیسک به صورت متراکم بر روی محیط کشت مولر هینتون آگار کشت داده شده و سپس چهار دیسک سفوتاکسیم-کلاوولانیک اسید، سفوتاکسیم، سفتازیدیم-کلاوولانیک اسید و سفتازیدیم با فاصله ی 15 میلی متر از یکدیگر روی آن ها قرار داده شدند، بعد از 24ساعت انکوبه کردن پلیت ها در دمای 37 درجه سلسیوس، در صورت مشاهده ی افزایش بیش از 5 میلی متر در قطر هاله هر کدام از آنتی بیوتیک های فوق در ترکیب با کلاوولانیک اسید نسبت به آنتی بیوتیک تنها، ارگانیسم ESBL مثبت و در غیر این صورت ارگانیسم ESBL منفی گزارش می شدند  ( واین2012).

 

2-24-1-3.آزمایش سه بعدی:

در این روش ابتدا باکتری که بتالاکتاماز منفی می باشد و به تمامی داروهای بتالاکتامی حساس می باشد را به صورت متراکم بر روی محیط کشت مولر هینتون آگار کشت داده و یک دیسک سفتریاکسون در مرکز پلیت قرار داده می شود. در پلیت چاهکی به فاصله ی 2 میلی متری دیسک ایجاد می شود و ژلوز آن قسمت تخلیه می گردد. سوسپانسیونی از باکتری مورد آزمایش با کدورت نیم مک فارلند تهیه کرده و داخل چاهک ریخته و پس از انکوباسیون 24 ساعته نتایج آزمایش مشاهده می شود. در صورتی که باکتری مورد آزمایش بتالاکتاماز مثبت باشد گسترش هاله ی عدم رشد باکتری حساس، به سمت دیسک مرکزی سفتریاکسون، در نواحی اطراف منطقه ی چاهک نشان دهنده ی تخریب دارو توسط این آنزیم و ایجاد امکان رشد برای باکتری حساس در حضور دارو می باشد.

 

2-25.شیوع بیمارستانی و ارزیابی میزان کنترل:

طریقه مصرف آنتی بیوتیک ها نیز باید تحت نظارت باشد تا آنتی بیوتیک هایی که مصرف آنها باعث خطر آفرینی می شود به میزان زیاد مورد استفاده قرار نگیرد. مطالعاتی نیز باید در مورد مصرف تک تک       آنتی بیوتیک ها صورت بگیرد تا مشخص شود که کدام آنتی بیوتیک ها باعث افزایش خطر شیوع سویه های اسینتوباکتر مقاوم به چند دارو می شود. اگرچه مصرف هر آنتی بیوتیک فعالی علیه باکتری های گرم منفی، همراه با ظهور سویه های اسینتوباکتر بومانی مقاوم به چند دارو می باشد، ولی سه گروه آنتی بیوتیکی هستند که بیشتر بر این امر دلالت دارند که شامل طیف وسیعی از کارباپنم ها، فلوروکینولون ها و سفالوسپورین ها       می شود. چندین مطالعه نشان می دهد، رعایت عواملی که در بالا ذکر شد می تواند تاثیر به سزایی در کنترل عفونت های ایجاد شده توسط اسینتوباکتربومانی داشته باشد.

بعضی از محققین پیشنهاد می کنند که برای ریشه کن کردن استقرار اسینتوباکتر می توان از تکنیک هایی نظیر استفاده از پلی میکسین به طور موضعی و یا تنفسی استفاده کرد. اگرچه از پیشنهاد چنین روش هایی به علت امکان ایجاد مقاومت ارگانیسم ها به پلی میکسین B امتناع می شود. بهتر است که برای تشخیص بهتر بیمارانی که این باکتری در آنها مستقر شده است، توجه بیشتری به آلودگی های محیطی شود و برای جلوگیری از انتقال بیماری به بیمار، بهبود بخشیدن و ارتقاء نظافت دست ها بسیار حائز اهمیت می باشد( سیفرت و همکاران، 1994 ).

در مطالعات پیشین منشاء متعددی برای انتقال اسینتوباکتر بومانی نظیر کاتترهای مکشی، ظروف آب مقطر، ظروف جمع آوری ادرار، لوله های دستگاه تهویه، ویال های مولتی دوز دارو و فیلترهای مرطوب کننده، مواد غذایی که از طریق داخل وریدی به بیمار داده می شدند شناسایی شده است( ویلر و همکاران، 2000 ).

ارتقای پاک سازی محیطی برای زدودن ارگانیسم از محیطی که بیماران می خواهند در آن بستری شوند ضروری می باشد. بهبود روش های جداسازی به منظور جلوگیری انتقال از طریق تماس و بالا بردن نظافت به ویژه نظافت دست ها باید انجام بپذیرد.

یکی دیگر از راه های جلوگیری از انتقال اسینتوباکتر بومانی، بستری کردن بیماران در اطاق های تک نفره می باشد که این امر در بسیاری از بخش ها غیر ممکن می باشد که هنوز هم مطالعات بیشتری برای شناسایی راه های کنترل و نفوذ اسینتوباکتر بومانی نیاز است.

Wayne

Three-Dimensionsl Test

Seifert et al.

Viller et al.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:24:00 ق.ظ ]




اپیدمیولوژی جهانی اسینتوباکتر بومانی:

در بیمارستان های آسیا و شرق میانه شیوع فراوانی از اسینتوباکتر گزارش شده است. میزان مقاومت در نمونه های Sentry در سال 2001 تا 2004 از 25% برای ایمی پنم و مروپنم،40% برای سفی پیم و سفتازیدیم، 40% برای آمپی سیلین-سولباکتام، 35% برای آمیکاسین و 45% برای سیپروفلوکساسین تجاوز می کرد.

 

2-27. روش مولکولی دخیل در بررسی باکتری های مولد آنزیم های بتالاکتاماز وسیع الطیف:

در حال حاضر، وظیفه ی تعیین هویت یک باکتری با قدرت تولید ESBL اختصاصی در نمونه های بالینی، بسیار پیچیده و حیاتی می باشد زیرا آزمایشات مجاورت دو دیسک، ترکیب دو دیسک و MIC با نوارهای E-test تنها به طور احتمالی وجود یک باکتری تولید کننده ESBL را روشن می کند.

در مطالعات اولیه معمولا تعیین نقطه ی ایزو الکتریک برای تعیین ESBL کافی بود و اکنون با وجود بیش از 172 نوع آنزیم تیپ TEM که بسیاری از آنها دارای نقطه ایزو الکتریک نزدیک به هم دارند این روش به تنهایی برای مدت طولانی مناسب نخواهد بود و این موضوع در ارتباط با آنزیم های تیپ blaVIM و blaNDM  نیز صدق می کند، بنابراین روش های دیگری نیز در دسترس می باشند.

 

روش های ژنوتایپینگ شامل روش های مبتنی بر PCR و غیر مبتنی بر PCR می باشند.

 

الف- روش های مبتنی بر PCR :

  • Multiplex PCR
  • Revers transcriptase PCR
  • Real Time PCR
  • Nested PCR

 

ب- روش های غیر مبتنی بر PCR :

  • الیگو تایپینگ
  • ریبو تایپینگ
  • پروب ژنی
  • پروفایل پلاسمیدی
  • RAPD
  • AFLP
  • PFGE
  • RFLP
  • MLST

 

2-27-1. واکنش زنجیره ای پلی مراز (PCR):

تکنیک PCR در سال 1984 توسط کری مولیس ارائه شده است و امروزه به عنوان یک ابزار مهم در فعالیت های تحقیقاتی و بالینی محسوب می شود.

PCR برای تکثیر بخش های خاصی از مولکول DNA مورد استفاده قرار می گیرد این بخش ها ممکن است یک ژن کامل یا قسمتی از یک ژن یا سکانس های بین ژن ها باشند در بسیاری از روش های PCR قطعات DNA های هدف حداکثر 10 کیلو جفت باز(KB) دارند اگر چه در بعضی از روش های خاص قطعات بزرگتر حتی تا Kb40 را هم می توان تکثیر کرد.

بعضی از کاربردهای PCR شامل کلونینگ DNA به منظور تعیین توالی، فیلوژنی بر اساس DNA آنالیز عملکردی ژن ها، تشخیص بیماری های ارثی، انگشت نگاری ژنتیکی در تعیین والدین و جرم شناسی و تشخیص بیماری های عفونی می باشند.

در روش PCR سیکل های دمایی ایجاد می شود ابتدا با ایجاد حرارت و رساندن دمای محلول به نقطه ذوب DNA دو رشته DNA از هم جدا می شوند. در مرحله بعد با کاهش دما یک آنزیم DNA پلیمراز فعال شده عمل همانند سازی را انجام می دهد. DNAپلیمراز آنزیمی است که با بهره گرفتن از نوکلئوتیدها (مصالح ساختمانیDNA ) و رشته الگو و یک قطعه پرایمر قادر به همانند سازی است.

صحت نتایج PCR بستگی به انتخاب پرایمر مناسب دارد، پرایمرها قطعات کوچک پلی نوکلئوتیدی هستند و در آزمایشگاه به گونه ای طراحی و سنتز شده اند که دارای سکانس نوکلئوتیدی مکمل با ناحیه /3 در مولکول DNA مورد نظر هستند. بنابراین به طور اختصاصی فقط به این مولکول ها متصل می شوند چون آنزیم DNA پلیمراز به قطعات پرایمر متصل می شود در نتیجه فقط مولکول DNA هدف همانند سازی و تکثیر می گردد.

با اعمال تغییرات دمایی به طور متوالی و برنامه ریزی شده روند PCR تکرار گردیده و در هر مرحله DNA دو برابر می شود بنابراین تعداد مولکول های DNA به صورت تصاعدی و به نسبت 2n  افزایش    می یابد که n تعداد سیکل های دمایی است مثلا یک مکولکول DNA پس از 20 سیکل به 586/047/1 مولکول تکثیر می شود. در مرحله همانند سازی برای جدا نگه داشتن دورشته DNA باید دمای محلول بالا باشد بنابراین از یک نوع آنزیم DNA پلیمراز مقاوم به حرارت استفاده می شود. اولین آنزیم که بدین منظور مورد استفاده قرار گرفت Polymerase Taq بود که از باکتری Thermus aquaticus بدست می آید.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:22:00 ق.ظ ]




واکنش زنجیره ای پلی مراز (PCR):

تکنیک PCR در سال 1984 توسط کری مولیس ارائه شده است و امروزه به عنوان یک ابزار مهم در فعالیت های تحقیقاتی و بالینی محسوب می شود.

PCR برای تکثیر بخش های خاصی از مولکول DNA مورد استفاده قرار می گیرد این بخش ها ممکن است یک ژن کامل یا قسمتی از یک ژن یا سکانس های بین ژن ها باشند در بسیاری از روش های PCR قطعات DNA های هدف حداکثر 10 کیلو جفت باز(KB) دارند اگر چه در بعضی از روش های خاص قطعات بزرگتر حتی تا Kb40 را هم می توان تکثیر کرد.

بعضی از کاربردهای PCR شامل کلونینگ DNA به منظور تعیین توالی، فیلوژنی بر اساس DNA آنالیز عملکردی ژن ها، تشخیص بیماری های ارثی، انگشت نگاری ژنتیکی در تعیین والدین و جرم شناسی و تشخیص بیماری های عفونی می باشند.

در روش PCR سیکل های دمایی ایجاد می شود ابتدا با ایجاد حرارت و رساندن دمای محلول به نقطه ذوب DNA دو رشته DNA از هم جدا می شوند. در مرحله بعد با کاهش دما یک آنزیم DNA پلیمراز فعال شده عمل همانند سازی را انجام می دهد. DNAپلیمراز آنزیمی است که با بهره گرفتن از نوکلئوتیدها (مصالح ساختمانیDNA ) و رشته الگو و یک قطعه پرایمر قادر به همانند سازی است.

صحت نتایج PCR بستگی به انتخاب پرایمر مناسب دارد، پرایمرها قطعات کوچک پلی نوکلئوتیدی هستند و در آزمایشگاه به گونه ای طراحی و سنتز شده اند که دارای سکانس نوکلئوتیدی مکمل با ناحیه /3 در مولکول DNA مورد نظر هستند. بنابراین به طور اختصاصی فقط به این مولکول ها متصل می شوند چون آنزیم DNA پلیمراز به قطعات پرایمر متصل می شود در نتیجه فقط مولکول DNA هدف همانند سازی و تکثیر می گردد.

با اعمال تغییرات دمایی به طور متوالی و برنامه ریزی شده روند PCR تکرار گردیده و در هر مرحله DNA دو برابر می شود بنابراین تعداد مولکول های DNA به صورت تصاعدی و به نسبت 2n  افزایش    می یابد که n تعداد سیکل های دمایی است مثلا یک مکولکول DNA پس از 20 سیکل به 586/047/1 مولکول تکثیر می شود. در مرحله همانند سازی برای جدا نگه داشتن دورشته DNA باید دمای محلول بالا باشد بنابراین از یک نوع آنزیم DNA پلیمراز مقاوم به حرارت استفاده می شود. اولین آنزیم که بدین منظور مورد استفاده قرار گرفت Polymerase Taq بود که از باکتری Thermus aquaticus بدست می آید.

 

مراحل PCR :

  • مرحله شروع: به مدت 1 تا 9 دقیقه، دمای محلول به 94 تا 96 درجه سلسیوس رسانده می شود(اگر پلیمراز ها به حرارت مقاوم باشند تا 98 درجه سلسیوس میرسانیم) این مرحله فقط برای DNA پلیمرازهایی ضروری است که نیازمند فعال شدن حرارت در روش PCR hot- start هستند.
  • مرحله واسرشت: این مرحله اولین قسمت از سیکل های حرارتی منظم است و شامل حرارت دادن محلول به مدت 20 تا 30 ثانیه در دمای 94 تا 98 درجه سلسیوس است در این مرحله به علت گسستن پیوند های هیدروژنی بین نوکلئوتیدها DNA الگو و پرایمر ها از هم جدا می شوند و تک رشته های DNA حاصل می گردد.
  • مرحله اتصال: دمای محلول به مدت 20 تا 40 ثانیه به مدت 50 تا 65 درجه سلسیوس کاهش می یابد. در این مرحله پرایمر ها به تک رشته های DNA الگو متصل می شوند و به طور طبیعی دمای اتصال در حدود 3 الی 5 درجه سلسیوس پایین تر نقطه ی ذوب پرایمر ها است. پیوند های هیدروژنی پایدار فقط زمانی شکل می گیرد که سکانس پرایمر و رشته الگو مکمل یکدیگر باشند. آنزیم پلیمراز پس از اتصال به هیبرید پرایمر الگو همانند سازی DNA را آغاز می کند.
  • مرحله طویل شدن: دمای محلول در این مرحله باید متناسب با نوع DNA پلیمراز مورد استفاده باشد. دمای اپتیمم برای آنزیم Taq polymerase حدود 75 الی 80 درجه سلسیوس است که معمولا دمای 72 درجه سلسیوس انتخاب می شود. در این مرحله آنزیم DNA پلیمراز با بهره گرفتن از  dNTPهای موجود در محلول، یک رشته DNA ی جدید را در جهت /5 به /3 و در مقابل رشته های الگو        می سازد، مدت زمان این مرحله نیز باید متناسب با نوع DNA پلیمراز و طول رشته DNA باشد. در دمای بهینه، DNA پلیمراز در هر دقیقه یک هزار باز را پلیمریزه می نماید. در مرحله طویل شدن در صورت وجود سوبسترای کافی و تامین شرایط بهینه مقدار DNA در محلول PCR دو برابر می شود بنابراین در هرسیکل PCR غلظت DNA به صورت تصاعدی افزایش می یابد.
  • مرحله طویل شدن: این مرحله پس از آخرین سیکل PCR به مدت 5 الی 15 دقیقه در دمای 70 الی 74 درجه انجام می شود تا اطمینان حاصل شود که همه تک رشته های DNA همانند سازی شده اند.
  • نگهداری نهایی:در این مرحله محلول نهایی به مدت کوتاهی در دمای 4 الی 15 درجه سلسیوس قابل نگهداری است.
  • الکتروفورز در ژل آگارز:نهایتا می توان محصولات PCR را بر روی ژل آگارز و همراه با مارکر وزن مولکولی الکترفورز نمود تا صحت انجام PCR بررسی شود.
موضوعات: بدون موضوع  لینک ثابت
 [ 08:21:00 ق.ظ ]




علل جغرافیایی

اوضاح واحوال و موقعیت جغرافیائی هر کشو و حتی هر منطقه در اعتیاد و  نوع متفاوت است. ساکنین شهرها وروستاهائی که در مسیر عبور مواد مخدر هستند به علت سهولت دسترسی به مواد مخدر و همکاری با قاچاقچیان بیشتر در خطر اعتیاد قرار دارند. اهم علل جغرافیایی در اعتیاد به شرح زیر است :

 

الف: رشد جمعیت

افزایش بی رویه جمعیت که یکی از مسایل حاد اجتماعی می باشد، آینده بشر مخصوصا نوجوانان و جوانان را تهدید می کند. جوانان در پیشرفت و توسعه اقتصادی، اجتماعی و فرهنگی وسیاسی هر کشور نقش به سزایی را ایفاء می نماید لکن با رشد بی رویه جمعیت، تمام آنها نمی توانند به تحصیلات خود ادامه داده و یا جذب بازار کار شوند ، عدم امکانات رفاهی ، تفریحی، بهداشتی و تهیه مسکن به خصوص نگرانی و نومیدی از آینده موجب ناراحتی روانی می گردد و آنان برای رهایی از فشار زندگی و فراموش کردن غم آینده به مصرف مواد مخدر روی می آورند. لیکن با توجه به اینکه در چند سال اخیر کشور ایران و باطبع شهرستان کاشان به کاهش جمعبت مواجهه گردیده به نظر می رسد رشد جمعیت تاثیر قابل توجهی در گرایش به اعتیاد نداشته هرجند در بعضی جوامع جزو علل گرایش به مواد مخدر رشد جمعیت می باشد.

عکس مرتبط با اقتصاد

 

ب: شهر و روستا

1)شهر :زندگی در شهر عامل مستقیم گرایش به اعتیاد در مواد مخدر نیست بلکه شرایط موجود در شهرهامخصوصاً ازدحام جمعیت، مشکل ترافیک، وضع مسکن، کمبود روابط عاطفی منجر به ناراحتی های روانی و خستگی جسمی می‌گردد و به علت فقدان همبستگی بین افراد خانواده و همسایگان بی اعتنائی به معنویات که سبب افزایش بی قیدی و بی‌بندوباری و بالاخره عدم انطباق اجتماعی گرایش به استعمال مواد مخدر افزایش می یابد.

 تصویر درباره جامعه شناسی و علوم اجتماعی

2  ) روستا : روستائیان که اکثراً دارای روابط عاطفی و صمیمی‌بوده و زندگی مسالمت آمیز دارند در غم واندوه هم شریک و در مصائب از  مساعدت وهمیاری به یکدیگر مضایقه نمی‌کنند از بسیاری از مفاسد زندگی در شهرها مصون می‌باشند ولی روستائیان که برای کار به شهرها می روند و به علت معضلات زندگی شهری که منجر به خستگی جسمی و ناراحتی‌های روانی می‌گردد به انواع مواد مخدر معتاد می‌شوند  ودر مراجعت به روستا ،سایرین را نیز به مصرف موادمخدر ترغیب و عده ای را معتاد می کند.

 

بند اول: مهاجرت

در تمام ادوار زندگی، بشر برای بقاء تهیه حوائج زندگی وامرار معاش از محلی به محل دیگر مهاجرت نموده است . از اوایل قرن بیستم، با پیشرفت حیرت انگیز علم و صنعت، هر سال میلیون ها نفر زادگاه خود را ترک و برای اشتغل به کار با شهرها و یا کشورها و قاره های دیگر مهاجرت می‌کنند. مهاجرت یا فردی و یا با اعضاءخانواده  و گروهی است .

 

الف ) مهاجرت به شهرها :

پیشرفت شبکه های مخابراتی ورسانه های گروهی دورافتاده ترین روستائیان را از مزایا و رفاه شهری آگاه می‌سازد. روستائیان به علت تهی دستی ودرآمد کم، کار مشقت بار، محرومیت از رفاه اجماعی و وسایل اموزشی، برای اشتغال به کار و کسب با درامد زیاد و یا ینل به آرزوهای خویش، به شهرها مهاجرت می‌کنند و با دیدن زرق و برق به ظاهر فریبنده شهرها و سایر مزایا بیشتر به محرومیت خود پی می‌برند.

در دیدار با روستائیان محرومی‌که در ده مانده اند و از مظاهر تمدن جدید وپیشرفت علوم، فقط یک رادیوترانزیستوری دارند دیدنی های شهر را به تفصیل شرح داده آنان را نیز تشویق به مهاجرت به شهرها می‌کند .

مهاجرین مذکور در توشه ووبار خود اعتقادات مذهبی و سنی قومی، آداب ورسوم زادگاه خویش را به همراه می‌برند. در محیط جدید با اوضاح و احوال کاملاً متفاوت با محیط ساده وصمیمی زندگی روستائی مواجه می‌گردند.

مهاجرین در بدو ورود به شهرها، به علت کمبود مسکن،  عدم امکان پرداخت کرایه منزل، با طرز رقت بار وتأثر انگیز در حاشیه شهرها با برپائی الونک ساکن می‌شوند.

چون در فن یا حرفه ای تخصص ندارند و استعداد و قابلیت آنان پرورش نیافته است به آسانی جذب بازار کار نمی‌گردند و در صورت اشتغال به کار، به اندک بهانه از کار برکنار و لاجرم برای امر امرار معاش به مشاغل کاذب از قبیل دوره گردی، روزنامه فروشی و دست فروشی و غیره رو می آورند قاچاقچیان با اطلاع از استیصال و بدبختی که مهاجرین دارند آنان را برای توزیعمواد مخدر وا می‌دارند.

اطفال و جوانانی که به تنهائی، بدون یار و یاور، محیط گرم وپرمحبت خانواده  را رها ساخته و به امید تحقق بخشیدن به آمال و ارزوهای رویائی خویش ،زادگاه خود را ترک می‌کنند حزن آور ترین سرنوشت مهاجرین رادارند.

جوانانی که برای کار در صنایع و یا کارهای ساختمانی از روستاهای محقر به شهرها سرازیر می‌شوند در محل اقامت جدید، با نهایت جدیت برای کسب معاش به فعالیت می پردازند ودر صورت اشتغال به کار و رفع نیاز و احتیاجات اولیه، از لحاظ روانی احساس غربت و دلتنگی نموده و غالباً پس از فراغت از کار، حالت افسرده و غمگین وی ا برعکس حالت تهاجمی و خشونت  و ستیزه جویی دارند خستگی جسمی، سوء تغذیه ، ندشتن وسایل رفاه و‌اسایش، سلامتی آنان را به مخاطره می اندازد. برای رفع خستگی و تألمات روانی، ابتدا ،به سیگار وسپس به سایر مواد مخدر معتاد می‌شوند.

عکس مرتبط با سیگار

موضوعات: بدون موضوع  لینک ثابت
 [ 08:19:00 ق.ظ ]




علل اقتصادی

عکس مرتبط با اقتصاد

فقر،بیکاری،گدایی و ولگردی ،بحران های اقتصادی، سود جویی و خرید و فروش مواد مخدر ، تبعیض طبقاتی و مشکلات مالی از جمله عوامل مهم کشیده شدن فرد به سوی مواد مخدر است .این عامل از طریق فراهم آوردن خیل خرده فروشان مواد مخدر صنعتی به گسترش اعتیاد کمک می کند ؛ با این توضیح که اعتیاد بین قاچاقچیان مواد مخدر نادر است اما بخش اعظم خرده فروشان ، مصرف کننده مواد مخدر هستند .در آغاز فرد برای دستیابی به پول و بر اساس نیاز مالی به خرید و فروش مواد می پردازند اما با ابتلا به اعتیاد ، این دلیل اولیه جای خود را به وابستگی و سوء مصرف مواد می دهد که این فرآند موجب تشدید فقر گردیده و سرانجام چرخه باطل فقر ، اعتیاد، فقر را به وجود می آورد.

تاثیر وضعیت اقتصادی برر رفتار و اخلاق آدمی از گذشته های دور مورد توجه دانشمندان بوده است . از افلاطون نقل شده است :"تقوای واقعی و ثروت فراوان مانعه الجمع هستند". جرم شناسان در این زمینه به دو گروه تقسیم می شوند: گروهی که گرایش به مکتب کمونیستس دارند، معتقدند که رفتار انحرافیافراد شدیدا متاثر از وضعیت بد اقتصادی آنها است. در نتیجه ، شرایط نا برابر توزیع ثروت و نامعادله بودن آن را عامل انحراف می دانند و این را که بیش تر منحرفان و مجرمان و بزه کاران و معتادان به مواد مخدر از اقشار پایین جامعه بوده و در محلات فقیر نشین و شلوغ و کثیف زندگی می کنند ، تاییدی بر ادعای خود می دانند. در مقابل این دیدگاه دسته ای دیگر از جرم شناسان رشد اقتصادی و باالا رفتن سطح زندگی را عامل انحراف می دانند .

اسلام هیچ یک از دو نظر را به عنوان عامل انحصاری نمی پذیرد؛ یعنی  از سویی فقر و تنگدستی راعامل بی توجهی به مسائل معنوی و ارزشها و هنجارها می داند و از سوی دیگر امکانات و اموال زیادی نیز خدا را از یاد انسان می برد.

فقر مادی و مالی باعث می شود که والدین تنها به فکر نیازهای تغذیه ای و پوشاک باشند و کمتر به تفریحات و مسافرت اهمیت دهند . وجود تفریح مسافرت باعث می شود تنش های روانی افراد کاسته شود و آرامش بیشتری بر زندگی شان حکم فرما شود ولی متاسفانه در خانواده های فقیر نه تنها ناراحتی ها کم نمی شود بلکه به دلیل وضعیت معیشتی که دارند روز به روز بر تنش های آنان افزوده می شود. در این خانواده ها غذا، پوشاک،هزینه ایاب و ذهاب،و سایر تسهیلات به سختی تامین می شود و در بعضی خانواده ها شدت فقر به حدی است که کودکان ناگزیرند برای تامین معاش خانواده به کار بپردازند و در مواردی جذب مشاغل کاذب و فروش مواد مخدر و اعتیاد می شوند.

بین فقر و اعتیاد رابطه وجود دارد و 39 در صد معتادین مورد نمونه از خانواده های فقیر و کم درآمد محسوب می شوند. از جمعیت نمونه آماری ما 24 نفر یعنی معادل 39% از خانواده های کم درآمد، 37% معادل 22 نفر دارای درآمد متوسط، 10 نفر معادل 16% دارای درآمد در حد کافی و 5 نفر از خانواده های درآمد بالا بوده اند.

- یعقوب رستمی ، بررسی شیوه های اثر بخشی پیشگیری از اعتیاد ، پایان نامه کارشناسی ارشد،1388 ص25

- محمد باقر مجلسی،بحارالانوار،جلد62،روایت7،ص27

موضوعات: بدون موضوع  لینک ثابت
 [ 08:18:00 ق.ظ ]




راه های مداخله و پیشگیری از اعتیاد

گسترش روز افزون جوامع، زندگی نوین اجتماعی، پیچیدگی فناوری و به دنبال آن تغییران مستمر در شرایط اقتصادی، اجتماعی، سیاسی و فرهنگی ظهور بزه و جرم را به شیوه‌های مختلف در سطح وسیعی افزایش داده که بازتاب آن به نوعی در بطن جامعه تاثیر گذاشته و آن را متحول ساخته است.

عکس مرتبط با اقتصاد

در این گذار سوء مصرف مواد مخدر نیز به صورت پدیده اجتماعی بسیار پیچیده‌ای در آمه است. به طوری که افراد به دلایل مختلف از جمله خصیصه‌های شخصی، شرایط زندگی، محیط اجتماعی، آرزوها و سرخوردگی‌ها مستعد گرایش به مصرف مواد مخدر می‌شوند و آن را بعنوان راه حلی برای مشکلات خود تلقی می‌کنند.

نظر به عوارض و مشکلات متعددی که این پدیده برای جوامع بشری به وجود آورده تاکنون تلاشهای زیادی در جهت مهار و پیشگیری آن به عمل آمده به طوری که می‌توان گفن هم اکنون اعتیاد یکی از مهمترین مباحثی است که توجه سیاستمداران ، متخصصین و پژوهشگران را به خود جلب کرده و آنها را بر آن داشته که در جهت مهار، کنترل و پیشگیری از این پدیده به ارائه راهکارهای علمی ـ کاربردی مبادرت ورزند.

پیشگیری از اعتیاد هم چون سایر جرایم و انحرافات اجتماعی از مقوله‌هایی است که نیاز به برنامه داشت. به بیان دیگر پیشگیری از اعتیاد صرفاً با مبارزه‌های نهادهای انتظامی و قضایی تحقق نمی‌یابد زیرا اعتیاد به مواد مخدر به عنوان یک بزه ریشه در فرهنگ عمومی و تعلیم و تربیت دارد و لذا در مهار آن ابتدا باید فرهنگ عمومی و نگرش مردم را نسبت به مواد مخدر متحول ساخت و باید سیاست پیگیری در کنار پیشگیری در جهت کاهش نرخ بزهکاری عمل نمود و بر اقدامات فرهنگی، رفاهی، اقتصادی و غیره تاکید نمود و با کار فرهنگی دراز مدت این فرهنگ‌های غلط و عامیانه را عوض کرد، در پیشگیری از اعتیاد علاوه بر ضرورت تعامل و همکاری وسیع نهادها و سازمانها، مشارکت مردمی از اهمیت ویژه‌ای برخوردار است. مهم ترین استراتژی‌ پیشگیری از اعتیاد را که در جهان مورد استفاده قرار می‌گیرد، به شرح زیر می‌توان خلاصه کرد:

 تصویر درباره جامعه شناسی و علوم اجتماعی

  • افزایش اطلاعات و آگاهی افراد در مورد خطرات و زیانهای مصرف مواد مخدر.
  • ارتقای سطح فرهنگ و تقویت باورهای مذهبی.
  • افزایش مهارت های زندگی مانند مهارت تصمیم گیری، حل مساله و ارتباطات اجتماعی.

 

مبحث اول: تعریف، مفهوم و اقسام پیشگیری

طبق اصل ۱۵۶ قانون اساسی یکی از وظایف قوه قضائیه، پیشگیری از وقوع جرایم (به طور مطلق) است ولی متأسفانه در طول ۹۰ سال و اندی سابقه تقنین در خصوص مواد مخدّر، تا به حال یا اصلاً به مسأله پیشگیری –که بهتر و آسانتر و کم هزینه تر از درمان است- در خصوص اعتیاد توجّهی نشده و اگر هم توجّهی شده صرفاً در حد شعار بوده و گام عملی برداشته نشده است.

موضوعات: بدون موضوع  لینک ثابت
 [ 08:17:00 ق.ظ ]




    • سایر انواع سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) هم نشانه های سرطان لوبولار و هم داکتال را دارند یا منشا نا مشخصی دارندAllred.,2010) ).

1-2- 2-تهاجمی

اکثر سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) تهاجمی یا نفوذی هستند . این سرطان ها وقتی آغاز می شوند دیواره های غدد یا مجاری را می شکنند و به بافت هایی که PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) را احاطه کرده اند می روند Allred.,2010) ).

مرحله

پیش آگهی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) به شدت تحت تاثیرمرحله بیماری است و مشخص کننده این است که آیا سرطان پس از تشخیص گسترش پیدا می کند یا نه (.,2010 (Edge & Compton.

سیستم اصلی مشخص کننده stage در سرطان سیستم  TNMاست. طبقه بندی تومورها بر پایه سیستم TNM،اطلاعات اندازه تومور و اینکه چقدر در بافت PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) گسترده شده (T)،میزان و گسترش به غدد لنفاوی(N)، و وجود یا عدم وجود متاستاز(گسترش به سایر ارگان ها)(M) را به کار می گیرد.بر پایه سیستم TNM ، stage های 0و1و2و3و4 را تعیین می کنند. Stage 0 معمولا به صورت درجا است. Stage1 شروع سرطان تهاجمی است و stage4 پیشرفته ترین نوع بیماری است.سیستم TNM اغلب کاربرد کلینیکی دارد(.,2010 (Edge & Compton.

سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) فقط یک نوع بیماری نیست بلکه انواع مختلف آن بر حسب زیر گونه های مولکولی متفاوت،فاکتور های خطر،رفتار های درمانی و پاسخ به درمان وجود داردو انواع مختلف سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) از نظر مولکولی با به کار بردن پروفایل های بیان ژن تشخیص داده شده است(Perou et al.,2000).

LuminalA :حدود40%از سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) luminalA هستند،که نوع عمومی سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) است. این نوع از سرطان ها ER+ و/یا PR+ وHER2- هستند،رشد کمی دارند،کم تر تهاجمی هستند(نسبت به بقیه انواع). به علت بیان گیرنده هورمون ها به هورمون درمانی پاسخ می دهند و پیش آگهی مطلوبی دارند. هر چند از نظر زنده ماندن مانند سایر انواع  یا حتی کم تر از بقیه هستند Blows et al.,2010)).

LuminalB:حدود10تا 20 % سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) luminalB  هستند.مثل تومور هایluminalA اکثر تومورهای luminalB ،ER+ و/یا PR+ هستند اما آنها با بیان HER2یا سرعت تکثیر زیاد(تعداد زیادی سلول های سرطانی به صورت فعال تکثیر می شوند) تشخیص داده می شوندCheang et al.,2009)).

Basal like:حدود10 تا 20 %سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) Basal like هستند و اکثر انواع سرطان هایBasal like،Triple negative نامیده می شوند چون هم ER - , PR- هستند و هم HER2-. تومورهایBasal like  در زنان آمریکایی و آفریقایی زیاد است و آن ها دارای موتاسیونBRCA1  هم هستند.زنانی کهBasal like  هستند پیش آگهی ضعیف تر و عمر کم تری نسبت به سایر انواع سرطان ها دارند چون درمان های هدف دار ندارندPerou& Borresen-Dale.,2011)).

HER2 enriched:حدود10% از سرطان های پستانHER2  زیاد تولید می کنند (HER2 یک پروتئین محرک رشد است) و گیرنده های هورمون استروژن و پروژسترون را تولید نمی کنند. شبیه به نوع Basal like  این نوع سرطان به صورت تهاجمی رشد می کند و گسترش می یابد و در مقایسه با سرطان های ER+ ، افراد عمر کم تری دارند.هر چند درمان های هدف برای آن ها وجود داردBlows)   et al.,2010).

 Infiltrating1

Stage2

targeted therapies1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:14:00 ق.ظ ]




حاملگی

حاملگی در سنین کم تر (کم تر از 30 سالگی) و تعداد بیشتر حاملگی باعث کاهش ریسک ابتلا به سرطان در مورد سرطان هایی که وضعیت گیرنده هورمون ها در آن ها مثبت است می گردد(Lambe et  al.,1994).

1-5-10-شیر دادن

اکثر مطالعات پیشنهاد می کند که شیر دادن ریسک کلی ابتلا به سرطان را در زنان کمی کاهش می دهد. یک علت کاهش احتمال ابتلا با شیر دادن ممکن است این باشد که شیر دادن مانع قائدگی می شود و مدت زمان سیکل های قائدگی کم تر می شود.احتمال دیگر تغییرات ساختاری است که شیر دادن در بافت PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ایجاد می کند et al.,2013-2014) Alteri).

دانلود تحقیق و پایان نامه

 

1-5-11-تراکم استخوان

تراکم استخوان در زنان یائسه با افزایش ریسک ابتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مرتبط است و یک مارکر برای نشان دادن استروژن اضافی ودر واقع تجمع استروژن است(Kerlikowske et al.,2005).

1-5-12-فاکتور های وابسته به شیوه زندگی

به کار بردن هورمون های پس از قائدگی Beral et al.,2011))،چاقی و اضافه وزن( La Vecchia et al.,2011)، فعالیت بدنی کمEliassen et al.,2010))،رژیم غذایی نامناسب و غنی ازچربی( Vera-Ramirez et al.,2013)،مصرف الکلSingletary &Gapstur.,2001))،تنباکو(Gaudet et al.,2013)و قرص های ضدبارداریCalle et al.,1996)) از عواملی هستند که باعث افزایش احتمال ابتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) می گردند.

1-5-13-سایر فاکتور های خطر

قرار گرفتن در معرض تشعشعاتPreston et al.,2009))،مصرف داروهایی مثل Diethylstilbestrol (برای جلوگیری از سقط جنین) Titus-Ernstoff et al.,2001))،آلودگی های محیطی مثل آفت کش ها Salehi et al., 2008)) وآلودگی های شغلی مثل قرارگرفتن در معرض درجات بالای اتیلن اکسید Steenland et al.,2003)) و شیفت های کاری شبانه Kamdar et al.,2013)) نیز با افزایش ریسک ابتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مرتبط هستند.

1-6-فاکتورهای ژنتیکی مرتبط با سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)

سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) یک بیماری به شدت ناهمگن است که در اثر تاثیر متقابل عامل های خطر وراثتی و محیطی ایجاد می شود و به تجمع پیشرونده تغییرات ژنتیک و اپی ژنتیک در سلول های سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) منجر می شود(شکل1-4).اگر چه شواهد اپیدمیولوژیک بر وجود عامل های خطر ویژه (مانندسن،چاقی،مصرف الکل،برخورد با استروژن در طول زندگی) تاکید دارد، وجود سابقه خانوادگی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) قوی ترین عامل خطر برای این بیماری به شمار می آید.تقریبا20%همه سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) را انواع خانوادگی تشکیل می دهند و از نظر بیماری زایی، وابستگی خاصی به ژن مستعد کننده ویژه آن بیماری دارندAntoniou& Easton DF.,2006)).

با وجود این که ژن های مسئول اغلب سرطان های خانوادگی PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) هنوز کشف نشده اند،حدود نیمی از سرطان های خانوادگی در اثر جهش های دودمان زایشی در ژن های سرکوبگر تومور رخ می دهند که نقش اغلب آن ها حفظ درستی و تمامیت ژنوم است(نوری دلویی وطبرستانی.،1389) این ژن ها مشتمل بر موارد زیر است:

  • ژن های BRCA1 ،BRCA2
  • TSGsهای مرتبط با نشانگان های سرطان خانوادگی نادر مانند p53، PTENو ATM
  • ژن های دیگر با خطر کم تا متوسط مانند CHEK2,BRIPI,PALB2,NBS1
  • ژن های ترمیم باز ناجور جفت (mismatch) مانند MSH2و MLH(نوری دلویی وطبرستانی.،1389)

ethylene oxide1

tumor suppressor genes(TSGs) 1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:09:00 ق.ظ ]




مطالعات هم بستگی ژنومی که گوناگونی های ژنتیکی (چند شکلی تک نوکلئوتیدی) را در وضعیت سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) خانوادگی بررسی می کنند و مطالعات مورد شاهدی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،گوناگونی های ژنتیکی رایج و با نفوذ کم را در دست کم120ژن نامزد مشخص کرده اند. در میان این ژن های نامزد،موارد تاثیر گذار اصلی که ارتباطی با خطر سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) دارند،ژن های دخیل در کنترل چرخه سلولی،متابولیسم هورمون های استروئیدی و مسیرهای انتقال پیام سلولی هستند( Easton et al .,2007).

آلل های مستعد کننده رایجCASP8,TGFB1,FGFR2,TNC9,MAP3K1,LSP1  قوی ترین و با ثبات ترین شواهد ارتباط با سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) را دارند Easton et al .,2007))

1-6-1- ژن های BRCA1,BRCA2

ژن های BRCA1,BRCA2 به ترتیب برروی کروموزوم 17q12-21 و13q 12-13 قرار دارند و جزء ژن های مرسوم سرکوبگر تومور به شمار می آیند،زیرا وجود یک نسخه از ژن معیوب به ارث رسیده برای مستعد شدن به سرطان کافی است،اگرچه از دست دادن آلل سالم برای ایجاد تومور لازم است.این ژن پروتئین های بزرگ چند کاره ای را رمز دهی می کنند که مکان های متعدد اتصال برای ارتباطات متقابل پروتئین-پروتئین دارند.ژن BRCA1سه قلمرو کارکردی عمده دارد و درچندین مجموعه پروتئینی شرکت دارد.هنوز مشخص نیست که کدام یک از کارکرد های پر شمارBRCA1,BRCA2  به نقش ویژه آن به عنوان یک ژن مستعد کننده سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و تخمدان منجر می شود.مطالعات اخیر نقش BRCA1 در تغییرات ubiquitinرا در پاسخ به آسیب بهDNA  و کنترل پویایی سانتروزوم مرتبط می دانند. به نظر می رسد که BRCA1 به شکل مجموعه ای با پروتئین های دیگر،در بسیاری از فرایند های سلولی شامل نوترکیبی هم ساخت،پاسخ آسیب به DNA،کنترل نقاط کنترلی چرخه سلولی،ubiquitination،تنظیم رونویسی،تغییر الگوی کروماتین،دو برابر شدن سانتروزوم و غیر فعال شدن کروموزوم x  موثر استTurnpenny & Ellard.,2011)).

فعالیت هایی که به  BRCA2نسبت داده می شود شامل همانند سازیDNAوترمیم همساخت، رونویسی،تغییر الگوی کروماتین،دو برابر شدن سانتروزوم و سیتوکینز می باشدGudmundsdottir &) Ashworth.,2006).

در مقایسه با سرطان های پراکنده PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،سرطان های خانوادگی PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ویژگی های خاصی دارند.مطالعات اخیر با بهره گرفتن از دو رگه سازی ژنومی مقایسه ایو تجزیه و تحلیل ریز آرایه DNA 2 به همراه  ایمونوهیستوشیمی و تکنیک FISH ویژگی های ژنتیکی و فنوتیپ ایمنی ویژه ای را برای این تومور ها نشان داده اند.آسیب شناسی و زیست شناسی مولکولی تومور های ناشی از جهش در BRCA1وBRCA2 با هم دیگر متفاوت است.تومور های مرتبط با جهش BRCA1 ویژگی های تهاجمی،شامل بروز زودرس،درجه بالای تومور،گیرنده استروژن (ER) و گیرنده پروژسترون (PR) منفی و سرعت تکثیر بالا را نشان می دهندChappuis et al.,2000)).

فنوتیپBRCA1، با نشان گر های شبیه بازال  یا سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) سه گانه منفی،بر اساس نیمرخ بیان ژن تعریف می شود.تومور های مرتبط با BRCA1 با به دست آوردن یا حذف های کروموزومی ویژه،بیان بیش از حد انکوژن های ویژه (c-myc وc-myb)، پروتئین های چرخه سلولی (cycin E) و نشان گرهای IHC برای فنوتیپ اپیتلیال بازال (سیتوکراتین های بازال،گیرنده های عامل رشد اپیدرمیFGFR، p-cadherin) مشخص می شوند.ویژگی های مهم دیگر شامل از دست دادن tp53،تنظیم کاهشی p27و منفی بودنHER2 می باشد.هر دو نوع سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) با جهش BRCA1و BRCA2،انکوژن TBX2را بیش از حد بیان می کنند و معمولا درجه تومور آن ها بالاتر از سرطان های پراکنده PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) استChappuis et al.,2000)).

ژن هایBRCA1وBRCA2 وترمیم DNA در شماری از سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) میزان بالایی از ناپایداری ژنومی از خود نشان می دهند.این ناپایداری ها با آنیوپلوئیدی،حذف شدن یا اضافه شدن های بزرگ کروموزومی،ناپایداری ریز ماهواره ها ،ناهنجاری های کروموزومی،تکثیرو سانتروزوم ها و تشکیل هسته های بسیار ریز مشخص می شوند. این تغییرات DNA ریشه در تغییر در مسیرهای مولکولی تنظیم کننده تکثیر سلولی ،تمایز ،آپوپتوز و ترمیم DNA دارد (Farmer et al.,2005).

یافته های متقاعد کننده ای وجود دارد که نشان می دهدBRCA1 بخش اساسی روند ترمیم می باشد.اختلال قابل توجه در نوترکیبی همتا و افزایش در فراوانی اتصال انتهایی غیر همساخت در سلول های بنیادی رویانی موش فاقد brca1 مشاهده شده است.سلول های توموری فاقد brca1 موش و فاقد BRCA1 انسانی به میزان قابل توجهی عدم ثبات ژنومی،ناهنجاری های کروموزومی فاحش و تکثیر سانتروزوم ها را نشان می دهندYarden & Papa.,2006)).

هم پروتئین BRCA1 وهم BRCA2 جزئی از مجموعه پروتئینی آنمی فانکونی هستند.FA یک اختلال ارثی نادر است که با نارسایی مغز استخوان،اختلال در پایداری ژنومی و افزایش بروز سرطان مشخص می شود.مجموعه پروتئینی FA مجری یک مسیر ویژه ی ترمیم از نوع همتا ضایعات DNA می باشد که چنگال همانند سازی را مهار می کند Mirchandani & D’Andrea.,2006))

Genomia association studies2

comparative genomic Hybridization1

DNA microarray 2

FA1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:08:00 ق.ظ ]




اپی ژنتیک

سرطان های پراکنده PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،افزون بر جهش های به ارث برده،از ساز و کار های اپی ژنتیک برای غیر فعال کردن شمار زیادی از ژن های ترمیم DNAاز جملهBRCA1,ATM,CHk2وp53 استفاده می کنند. اپی ژنتیک بیانگر تغییراتی در کروماتین و DNA است که بیان ژنی را تغییر می دهد،اگر چه تغییرات در توالی DNA را شامل نمی شود.این مساله بر خلاف سازوکار های ژنتیک می باشد که در آن تغییرات در توالی DNA می تواند موجب تغییر در بیان ژن شده و یا یک فرآورده پروتئینی تغییر یافته را رمز دهی کند.در سرطان ،سازوکار های عمده اپی ژنتیک که به بیان ژن غیر عادی منجر می شوند،شامل متیله شدن غیر عادی جزایر CPGپروموتر،تغییرات کلی در متیله شدن DNA ژنومی و دگرگونی در تغییرات هیستونی (داستیله شدن و متیله شدن) می باشند. این اختلالات با مهار گر های مشتمل بر DNA متیل ترانسفراز و نیز HDAC قابل برگشت هستندBird.,2007)).

پیشنهاد شده است که متیله شدن پروموتر ممکن است به عنوان ضربه دوم در فرضیه دو ضربه ای نادسون از طریق غیر فعال کردن آلل طبیعیTSGعمل کند.بیش متیله شدنBRCA1در جزایر CPG پروموتر در زیرگروهی از تومورهای PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) پراکنده رخ می دهد و ممکن است به عنوان نخستین ضربه با غیر فعال کردن یک آللBRCA1 عمل کند. به دنبال آن از دست رفتن دومینBRCA1رخ می دهد.به نظر می رسد که متیله شدنBRCA1 در سرطان پراکنده PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) موجب فنوتیپ توموری می شود،مشابه آن چه در تومور های حاملان جهشBRCA1رخ می دهد. بر عکس،از دست دادن  بیان ژن BRCA2از طریق متیله شدن غیر عادی پروموتر در سرطان های پراکنده رخ نمی دهد( Esteller et al.,2001).

متیله شدن DNA برخی ژن ها ی خاص(مانندHIN-1RASSF1A,CYP26A1,KCNAB1,SNCA, TWIST,Cyclin D2) هم در ضایعات پیش بدخیم،مانند هیپرپلازی غیر معمول و هم در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مشاهده شده است.این یافته ها نشان می دهند که تغییرات اپی ژنتیک معمولا در مراحل ابتدایی ایجاد تومور PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) رخ می دهند و ممکن است به عنوان نشانگرهای بالقوه برای تشخیص زودرس یا ارزیابی خطر به کار روند.تغییر در وضعیت متیله شدن برخی از ژن ها مشتمل برα ER-,ER-β,cyclin D2,RAR-b,TWIST,RASSF1A,HIN-1 که اغلب و به نحو ویژه در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) بیش متیله می شوند و نیز ارتباط آن با تغییرات درc-reactive protein،سطح چربی خون،تراکم PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مقابل و غلظت استروژن در دست بررسی استFackler et al.,2006)).

1-8-مسیر های انتقال پیام سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)

مسیر های گیرنده های عامل رشد :گیرنده های عامل رشد نقش اساسی هم در آغاز مسیر های تکثیر و هم بقای سلولی درپستان وسایر بافت های اپیتلیال دارند.از نظر زیست شناسی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،EGFR  ها و گیرنده های عامل رشد مشابه انسولینبیشتر از همه مورد مطالعه قرار گرفته اند. این گیرنده ها یک ناحیه اتصال به لیگاند برون سلولی،یک ناحیه میان غشایی و یک قلمرو سیتوپلاسمی حاوی تیروزین کیناز دارند که می تواند آبشار انتقال پیام رو به پایین را فعال کند.گیرنده های عامل رشد می توانند از طریق سطح زیاده از حد لیگاند،جهش های فعال کننده یا تکثیر یا بیان بیش از حد ژن به شکل پیوسته فعال شوند که در نهایت منجر به فعالیت کینازی نا متناسب و فعال شدن پیامبر های ثانویه ی پیشبرنده ی رشد شودHellman & Rosenberg.,2005)).

شواهد متعدد ی نشان می دهد که EGFR(HER1,Erbb1) و HER2(EGFR2 یاErbB2) گیرنده هایی هستند که به ویژه به زیست شناسی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مرتبط می باشند و می توانند هدف های بالقوه ی دیگری را برای درمان سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) فراهم آورند.در چندین مطالعه نشان داده شده است که تکثیر یا بیان بیش از حد HER2 در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) متاستاز شده،یک نشانگر مستقل پاسخ به پادتن مونو کلونالanti-HER2  ،trastuzumab(Herceptin) می باشدHellman & Rosenberg.,2005)).

انتقال پیام با واسطه عامل رشد مشابه انسولین (IGF-1) و گیرنده های آن (IGF-IR) ،افزون بر فعال شدن مسیرEGFR،می تواند به فسفوریله شدن و فعال شدن کیناز های انکوژنیک گوناگونی از جمله PI3-KوHER2منجر شود.IGF-IRواسطه اولیه پاسخ بهIGF  است و در همه انواع سلول های اپیتلیال بیان می شود.مولکول های آداپتور مانند سوبسترای1گیرنده انسولین واسطه انتقال پیام IGF-1 از طریق فسفوریله شدن تیروزین IGF-IR می باشند.سطح بالای IGF-1 به عنوان عامل خطر سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) مطرح استRenehan et al.,2006)).

Insulin-likegrowth factor1

down stream signaling cascade2

Insulin receptor substrate 3

موضوعات: بدون موضوع  لینک ثابت
 [ 08:06:00 ق.ظ ]




در چندین کار آزمایی پیش بالینی نشان داده شده است که IGF-IR هدف موثری به نظر می آید واز این رو،کارآزمایی های بالینی که مهارگر های IGF-IR را بررسی می کنند،در دست انجام است.دو نوع گوناگون پادتن بر علیه IGF-IR در کار آزمایی مرحله 2 در حال ارزیابی هستند.پادتن های مونوکلونال بر علیه IGF-IR می توانند internalization گیرنده را به جریان انداخته و به نحو موثری سطح IGF-IRرا در سطح سلول،دست خوش تنظیم کاهشی کنند. بنابر این پادتن های علیه IGF-IR موجب مهار انتقال پیام هم IGF و هم انسولین در سلول های سرطانی می شوند.افزون بر این،مهار گرهای ضد IGF-IR با مولکول کوچک تولید شده اند که برخی از آن ها،گرچه بسیار اختصاصی نیستند،اما در مطالعات پیش بالینی بسیار موثر بوده اند.در واقع،مهارIGF-IR وEGFR می تواند درمان ترکیبی مفیدی باشدRenehan et al.,2006)).

1-8-1- مسیر PI3K

مسیر فسفاتیدیل اینوزیتول3-کیناز((PI3-Kدر پاسخ به عامل های متعددی فعال می شود وبه افزایش رشدوتکثیر سلولی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) منجر می شود.جهش های فعال کننده در ژنی که زیر واحد کاتالیتیک p110-a  PI3K (PI3CKA) را رمز دهی میکند،ممکن است عامل موثری در پیشرفت تومور PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) باشد.جهش های فعال کننده در خانواده ژنیAKT نادر هستند((Bachman et al.,2004

PTEN،قلمروکاتالیتیکPI3-Kرا دفسفوریله و در نتیجه غیر فعال می کند و در بسیاری از سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) یا جهش پیدا می کند یا (برای نمونه از طریق متیله شدن) کم بیان می شود.فعال شدن مسیرPI3-Kبه نوبه خود،موجب فعال شدن وابسته به3-فسفو اینوزیتاید چندین کیناز شناخته شده می شودکه از آن جمله می توان بهAKT1,AKT2وAKT3با واسطه کیناز اشاره نمود. به نظر می رسدAKT فعال آنتی آپوپتوتیک باشد.اگر چه در عین حال یک نقش تهاجمی هم در تشکیل تومور ایفامیکند (Cassimeris et al.,2011)

1-9-رگزایی

فرایند رگزایی تومور حائز اهمیت بسیار بالا و هدف مهمی برای درمان بسیاری از سرطان ها به شمار می آید. افزون بر سلول های آندوتلیال،سلول های سرطانی PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) هم گیرنده VEGFR را بیان می کنند.VEGFR ها، مانند EGFRها ،گیرنده های تیروزین کیناز هستند. VEGF-Aهم به (F1t-1) VEGFR1وهم به (KDR/F1K1) VEGFR2 متصل می شود. به نظرمی رسد VEGFR2واسطه تقریبا همه پاسخ های سلولی شناخته شده به VEGFها باشد،در صورتی که کارکردVEGFR1کمتر مشخص شده است.Bevacizumabیک پادتن مونوکلونال انسانی علیه VEGF-a است ودر مطالعات پیش بالینی نشان داده شده است که موجب کاهش رگزایی می شود. مهارگرهای فعالیت تیروزین کینازی VEGFRبا اندازه مولکولی کوچک،مانند sunitinib در بسیاری از سرطان ها موثر نشان داده شده اند و ممکن است تاثیر بخشی بالینی در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) هم داشته باشندTabernero.,2007)).

1-10-عامل های پیش آگهی مولکولی

سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) یک بیماری نا همگن است و سال هاست که این اعتقاد وجود دارد که تومور هایی که ویژگی های زیست شناختی متفاوتی دارند،نتایج بالینی و پاسخ های درمانی متفاوتی دارند.در حال حاضر،پیش آگهی و انتخاب درمان در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) بر اساس تعیین وضعیت گیرنده های هورمون رشددرتوموراست. تکثیر سلولی ویژه مهم سرطان است و پروتئین های هسته ای غیر هیستونی ki67،نشانگر مناسبی برای این فرایند است.رنگ آمیزیki67 می تواند هم به عنوان یک نشانگر سودمندی درمان،از طریق اندازه گیری های متعدد بر روی نمونه های  بافتی پی در پی در حین درمان،به کار رودDowsett & Dunbier.,2008)).

از سال 2007 به بعد چندین نیمرخ بیان ژن"پیش آگهی بد” با بهره گرفتن از ویژگی های فنوتیپی گوناگون زیست شناسی سرطان مهاجم مانند پاسخ به زخم و پاسخ به کمبود اکسیژن،ایجاد شده است. تجزیه و تحلیل های گذشته نگر نشان می دهند که این الگو های ژنی،اطلاعات پیش آگهی مستقلی،بهتر و بیشتر از آنچه که با بهره گرفتن از نشانگر های آسیب شناختی مرسوم مانند اندازه تومور،وضعیت غده لنفاوی،درجه،تهاجم لنفی - عروقی و وضعیت هورمون – گیرنده به دست می آید ،در اختیار قرار می دهد.تلاش در جهت ترکیب سه الگوی بیان ژن،دقت پیش آگهی را بهبود نبخشید Fan et al.,2006)).

 3-phosphoinositide1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:05:00 ق.ظ ]




آزمون نسبت بیان ژن سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)یک الگوی بیان دو ژنی ساده است که نسبت ژن هایHOXB6,IL17BR را که توسط استروژن تنظیم می شوند،اندازه گیری می کند.این نسبت به نحو قابل توجهی با میزان کم بقا بدون وجود بیماری،در مبتلایان به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) غده لنفاوی منفی،گیرنده استروژن مثبت و درمان با تاموکسیفن،مرتبط می باشد.اخیرا اضافه شدن پنج ژن مربوط به چرخه سلولی به این آزمون،به منظور در بر گرفتن درجه مولکولی،اجرای آن را بهبود بخشیده استDowsett & Dunbier.,2008)).

پنج ژن اضافه شده جزئی از شاخص درجه ژنومی 97 ژنی پیچیده تری هستند که به منظور رده بندی تومور ها به دو گروه با خطر کم و زیاد ایجاد شده است.ژن های استفاده شده در الگوی درجه ژنومی بیش تر در تنظیم چرخه سلولی و تکثیر نقش دارند.هنگامی که از این الگو در جمعیت بیماران با گیرنده استروژن مثبت استفاده شد،هم در بیماران درمان شده با تاموکسیفن و هم در موارد بدون درمان سیستمیک،گروه هایی با دو نتیجه بالینی از نظر آماری متفاوت شناسایی شد.با وجود این که شاخص درجه ژنومی تقریبا به طور اختصاصی از ژن های تکثیری تشکیل شده است،نمره های شاخص درجه ژنومی با رده بندی های شناخته شده لومینال A و B و با گروه های خطر شناخته شده توسط آزمون های  Mammaprint ,oncotype DXوالگوی 76 ژنیRotterdamمرتبط می باشد. به دلیل آن که ژن های مرتبط با تکثیر در همه این آزمون های بیان ژن به وفور وجود دارد،این ارتباط ممکن است بیانگر اهمیت تکثیر به عنوان یک عامل پیش آگهی در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) باشدDowsett &) Dunbier.,2008).

 

1-11-تنظیم هورمونی

میزان مواجهه با استروژن،عامل خطر پذیرفته شده ای برای ایجاد سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ER مثبت می باشد.استروژن یک هورمون استروئیدی است که اثر تکثیرکنندگی شدیدی برروی اپیتلیوم PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) طبیعی انسان از طریق فعال کردنERα دارد که یک گیرنده ی هورمونی هسته ای معمولی دارد. ERαدر70درصد موارد سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) بیش از حد بیان می شود.به نظر می رسد تکثیرERαیک سازوکار عمده باشد،اگرچه سازوکار های دیگری هم وجود دارد.امروزهERα هنوز یکی از موثرترین  اهداف برای درمان و پیشگیری سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) محسوب می شود و آنتی استروژن ها جزئی از رژیم های درمانی توصیه شده برای همه توده های بیان کننده ERαهستند.استروژن اثر خود را از طریق سازوکار های ژنومی و غیر ژنومی اعمال می کندHellman & Rosenberg.,2005)).

بافت PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) انسان مراحل متعددی از تکثیر،تمایز و پسرفت را طی میکند که توسط تغییر در سطح هورمون در گردش خون و طی دوره های قائدگی و کهولت ایجاد می شود،هورمون های تخمدانی و به خصوص استروژن،نقش کلیدی در سبب شناسی و زیست شناسی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ایفا می کنندEigeliene et al.,2006)).

استروژن نقش بسیار مهمی در ایجاد و پیشرفت سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) به عهده دارد،این تاثیر در سه تا از قطعی ترین عوامل خطر سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) که با تغییرات ترشح استروژن مرتبط اند، منعکس می شود.این سه عامل خطر عبارتند از: سن اولین قاعدگی(منارک)،سن زمان یائسگی و سن در زمان اولین حاملگی با دوره کامل. سرطان های PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) که از نظر گیرنده های استروژنی مثبت هستند(ER+)،سرعت رشد کمتری دارند،به خوبی تمایز پیدا میکنندوطول عمر بدون بیماری طولانی تری را برای بیماررقم می زنند) Shao& Brown.,2004).

در معرض استروژن بودن در طول زندگی،نقش مهمی در تعیین خطر ابتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ایفا میکند به همین دلیل است که منارک زودرس و یائسگی دیررس از عوامل خطر ابتلای به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) هستند چرا که فرد در طول زندگی خود،مدت بیشتری در معرض استروژن بوده است و نیز به همین دلیل است که چاقی نیز یک عامل خطر برای سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) به شمار می رود،به خصوص اگر چاقی پس از سنین یائسگی باشد چرا که در این سنین بافت چربی منبع اصلی تولید استروژن در بدن است و بدن افراد چاق معمولا در معرض استروژن بیشتری قرار می گیردHuang et al.,2005)).

البته در برخی تحقیقات نشان داده شده است که ترکیباتی تحت عنوان Adipokines شاملLeptin  وAdiponectin که از بافت چربی ترشح می شوند،در زیست شناختی سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) در افراد چاق نقش دارند.این عوامل با فعال کردن گیرنده های استروژنی و افزایش رشد سلول ها از طریق القای تولید عروق جدید در ایجاد سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) در افراد چاق اثر دارند. این عوامل در کاربری مهار آنها در جهت مداخلات درمانی در سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،شایان توجه است(Vona-Davis & Rose.,2007)

در طی هر دوره قائدگی،استروژن از تخمدان آزاد شده و وارد گردش خون می شود و در بافت هایی که گیرنده مخصوص استروژن دارند(PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و رحم) به گیرنده متصل می شوند. ترکیب استروژن با گیرنده مخصوصش،مجموعه ای را تشکیل می دهد که وارد هسته سلول می شود و به مناطق خاص در DNA سلول متصل می شود و باعث شروع یکسری وقایع در ژن ها می شود.استروژن با تاثیر در مرحلهG1در چرخه سلولی،سلول را وادار به تقسیم میکند و از آنجا که باعث تحریک تقسیم سلولی می شود،شانس اشتباه درگیری های متعددی که DNA حین تقسیم متحمل می شود افزایش می یابد،لذا امکان جهش نیز بالا می رودFoidart et al.,1998)).

Breast cancer gene expression ratio test1

genomic grade index2

Regression1

Angiogenesis1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:04:00 ق.ظ ]




PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) یک بافت منحصر به فرد است چرا که بر خلاف اکثر بافت های بدن که در زمان تولد،سیر تکامل خود را به طور کامل طی کرده اند،در مرحله نابالغ [1] باقی مانده است،پس از شروع اولین تکانه[2] های استروژنی که از تخمدان و با شروع بلوغ،ترشح می شود،سلول های بنیادین[3] سیر تکاملی خود را شروع می کنند. این سلول های نابالغ حساسیت ویژه ای به مواد سرطان زا دارند و هم چنین توانایی کمتری برای ترمیم آسیب های وارده به DNA خواهند داشت.این حساسیت از ابتدای تولد تا 4 سالگی و از شروع بلوغ تا اولین حاملگی با دوره کامل در بیشترین میزان خود قرار دارد.فقط با تکمیل دوره حاملگی و شیردهی است که یک سلول PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) به مرحله نهایی بلوغ خود یعنی تولید شیر دست می یابدDontu & Wicha.,2005))

دانلود تحقیق و پایان نامه

گیرنده های استروژن دو نوع α و βدارند،نوع α برای رشد مجاری پستانی طی دوره بلوغ ضروری است Shyamala et al.,2006)).

از آنجا که حدود70% از تومورهای PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) ER+ هستند و برای رشد خود به استروژن وابسته اند،از داروهای ضد استروژن مثل تاموکسیفن به عنوان یکی از مهم ترین درمان های ضد سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) استفاده می شود.این دارو باعث مسدود شدن اتصال استروژن به گیرنده مخصوص خود می شود و بدین ترتیب از اثرات استروژن در القای تقسیمات پیاپی در سلول های سرطانی ممانعت می کند Levin & Pietras.,2008)).

به دلیل تاثیر عمیق و قطعی استروژن در ایجاد و پیشبرد تومورهای PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) است که مراقبین سلامت جامعه توصیه می کنند جهت کاستن از خطر ابتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)،بایستی طول مدتی را که یک خانم در طول زندگی اش در معرض استروژن قرار می گیرد تا حد امکان کاهش داد مثل کنترل وزن و پرهیز از چاقی در سنین بعد از یائسگی و محدود کردن یا مصرف با احتیاط درمان های هورمونی جایگزین Ito.,2007)).

گیرنده های استروژن به رده­ی گیرنده های هسته­ایNR3 تعلق دارند. این رده علاوه بر ERها شامل گیرنده های پروژسترون،آندروژن،گلوکوکورتیکوئیدومینرالوکورتیکوئیدکه واسطه­ تاثیرات اندوکرینی استروئیدها می­باشندو نیز گیرنده های اورفانERRα-γ می­شوند.به لحاظ کلاسیک، گیرنده هایNR3 به عنوان فاکتورهای رونویسی هسته­ای عمل می­ کنند. بهرحال،طی سال­های اخیر، کشف ایزوفرم­های گیرنده،همراه با شناسایی روش عمل و مسیرهای پیام­رسانی که با استروئید شروع می­شوند موجب شده­است دانش بشردر مورد عملکرد استروژن بیشتر شود و عناصر تنظیمی که نقش آن­ها در سرطان را تنظیم می­ کنند شناسایی شده ­اند.تاثیرات استروژن در رونویسی هسته­ای در سطح وسیعی مرورشده­است، و تاثیراتی که در سرطان مربوط به اندوکرین دارند نیز بسیار مطالعه­شده استKampa) et al.,2013).

1-12-توالی گیرنده استروژن

دو فرم مختلف از گیرنده های استروژن وجوددارند: ERα وERβ.آن­ها توسط دو ژن مجزا که به ترتیب روی کروموزوم­های6و14قراردارند کدمی­شوندودوپروتئین با595و530 اسیدآمینه راکدمی­کنند. ساختار داخلی ژن­های گیرنده استروژن دارای 8 اگزون استGreene et al.,1986)).

مثل همه اعضای خانواده گیرنده های هسته­ای،ERهاشامل یک ساختار داخلی با 6 دومین A-F که به لحاظ تکاملی محافظت شده ­اند می­باشند:درNترمینال،دومین­های A/Bدارای عملکرد فعال­سازی رونویسی1[4] هستند،که یک بخش فعال­کننده­ رونویسی مستقل از لیگاند گیرنده است؛ دومین به شدت حفاظت­شده­یCدومینی است که بهDNAمتصل می­ شود؛دومینDمنطقه لولایی[5] است ومسئول فراخوانی، اتصال،وعملکردتعدادی از co-modulators های گیرنده است.دومین­هایEوF دارای دومین اتصال به لیگاند هستند،که همراه با (AF2)[6] که فعال­کننده­ رونویسی وابسته به لیگاند است نقش خود را ایفامی­کنندNilsson et al.,2001)).

Immature2

Impulse3

stem cell4

Activation function1 (AF1)1

موضوعات: بدون موضوع  لینک ثابت
 [ 08:02:00 ق.ظ ]




Real timePCR

واکنش زنجیره ای پلیمراز یا PCR در سال های اخیر به عنوان یک استاندارد طلائی جدید،جهت شناسایی طیف وسیعی از الگو ها مورد استفاده واقع شده است.در روش های سنتیPCR،ردیابی محصول در نقطه انتهایی انجام می شود در صورتی که در روش های Real timeعمل ردیابی محصول در حین انجام واکنش و به موازات پیشرفت آن،سیکل به سیکل انجام می گردد.در روش های سنتی PCR،بررسی محصول در مرحله ایستا و یا در نقطه انتهایی و اما در روشPCR Real timeدر طول فاز اولیه یا زود یا فاز رشد انجام می شودTichopad .,2004)).

کاربرد های Real timePCR

1-اندازه گیری میزان بیان ژن

2-بازده اثر دارو

3-شناسایی عوامل بیماری زا

4-ژنوتایپینگ

5-شناسایی موتاسیون

6-شناسایی پلی مورفیسم تک نوکلئوتیدPersing et al.,2004)).

روش های سنجش با Real timePCR

به طور کلی چندین روش برای انجام PCR کمی با بهره گرفتن از Real timePCR وجود دارد) Tichopad .,2004).

فرم غیر اختصاصی

این روش با بهره گرفتن از عوامل متصل شونده به DNA مثل SYBRgreen به انجام می رسد. این رنگ از طریق جایگزینی در شکاف کوچک DNA به آن متصل می شود. از جمله مزایای این روش ارزان،راحت و حساس بودن آن است.یکی از معایب بزرگ آن این است که با اتصال به دو رشته ای هایی مثل پرایمر دایمر و دیگر باند های غیر اختصاصی ،نتایج بیشتر از غلظت اصلی برآورد می شودوبنابراین اپتیمایز کردن آن باید به صورتی باشد که پرایمر دایمر و دیگر محصولات  غیراختصاصی به حداقل ممکن برسد.برای رفع این مشکل از آنالیز منحنی ذوب  استفاده می شود.از آن جایی که SYBRgreen نمی تواند بین محصولات مختلف تفاوتی قائل باشد می توان با بهره گرفتن از منحنی ذوب تنوع محصولات را در PCR مشخص کرد. بعد از اینکه PCR به پایان رسید دستگاه قادر است نمودار ذوب هر نمونه را رسم کند. این کار به وسیله اندازه گیری تغییرات فلورسانس در دماهای مختلف صورت می گیردTichopad .,2004)).

مراحل انجام کار به این صورت است که برای ترسیم منحنی دستگاه دمای نمونه ها را در فواصل زمانی مشخص (مثلا هر10 ثانیه) به مقدار معینی تغییر می دهد.برای مثال ابتدا دستگاه دمای نمونه ها را به 94 درجه سانتیگراد می رساند.در این حالت تمام DNA ها به صورت تک رشته ای هستند و میزان سایبرگرین متصل شده حداقل است. در نتیجه میزان فلورسانس ساطع شده کم می باشد. به تدریج دستگاه دمای نمونه ها را 5/0درجه سانتی گراد کاهش داده و10 ثانیه در آن دما ثابت می ماند و در این مدت نور ساطع شده از نمونه ها توسط دستگاه اندازه گیری می شود. هم زمان با این عمل منحنی تغییرات فلورسانس بر حسب دما که همان منحنی ذوب است ترسیم می گردد(شکل1-11) Tichopad .,2004)).

در نقطه ذوب50% پیوند های هیدروژنی در DNA های دو رشته ای از هم جدا شده و میزان فلورسانس بطور ناگهانی تغییر می یابد. در این منحنی هر یک از peak ها نمایانگر یک محصول PCR است. بنابراین با آنالیز منحنی ذوب می توان وجود باندهای غیر اختصاصی و پرایمر دایمر را تشخیص داد. نرم افزار،سرعت تغییرات را به صورت RFUدر محورy و دمای دستگاه را در محورx نشان می دهد. نقاط ماکزیمم نمایانگر یک محصول PCR است.peak هایی که در دمای پایین تر هستند نشان دهنده قطعات کوچکتر هستند Tichopad .,2004)).

فرم اختصاصی

در این مدل از مکانیسم FRET استفاده می شود.در این مکانیسم پروب ها طوری طراحی می شوند که در ابتدای پروب یک رنگ فلورسانس به نام Reporter و در انتهای آن فلورسانس دیگری به نام Quencher قرار می گیرد. وقتی که Reporter و Quencherدر فاصله مولکولی نزدیک به یکدیگر قرار دارند (درحالت اتصال به پروب) نوری که به Reporter می خورد باعث ایجاد یک تابش می شود که طول موج این تابش در ناحیه تحریک Quencher بوده وQuencher ضمن جذب این نور تابشی را در طول موج بلند تر ساطع می کند که توسط دستگاه قابل ارزیابی نمی باشد. پس از جدایی Reporter و Quencherنور ساطع شده از Reporter توسط  Quencherقابل جذب نبوده و در این حالت دستگاه نور ساطع شده را به صورت فلورسانس اندازه گیری می نماید Tichopad .,2004)).

روش های تعیین کمیت با Real timePCR

یکی از مهم ترین کاربرد هایReal timePCR تعیین کمی مقدار ژن بیان شده است که به دو روش صورت می گیرد: کمیت سنجی مطلقو کمیت سنجی نسبیTichopad .,2004)).

در کمیت سنجی مطلق تعداد دقیق کپی های یک ژن مشخص می گردد در حالی که کمیت سنجی نسبی، نسبت بیان یک ژن به ژن دیگر یا به عبارتی تغییرات کمی در بیان یک ژن را نشان می دهد Tichopad .,2004)).

DNA minor groove1

Melt Curve Analysis2

Relative Fluorescence Unite1

Emission 1

Absolute Quantification2

Relative Quantification 3

موضوعات: بدون موضوع  لینک ثابت
 [ 08:01:00 ق.ظ ]




انسان بزرگترین کاربر زمین است و برای فراهم آوردن نیاز خود، بیشترین بهره را از زمین می برد. این بهره‏‏‏‏‏‏‏‏­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­­‌‏‏وری روز افزون، بدون پیامد نیست. انسان به نسبت بهره­مندی از طبیعت برای فراهم آوردن خوراک و پوشاک و ساخت و پرداخت دستگاه­هایی که شیوه و روند زندگی را بهبود می­بخشد، پسماند و دوریز تولید می کند. پسماندهای که برخی به طبیعت باز می­گردند، برخی بازیافت شده، دوباره به چرخه تولید و بهره وری باز می­گردند و برخی دیگر که روی دست طبیعت و انسان می­مانند و چاره ای نمی­ماند مگر کاستن  خطر و آلودگی آن­ها و پنهان کردن آن در دل خاک تا شاید خاک خود راهی برای دگرگونی و بازیافت این مواد باشند.

Efficiency بهره وری

پسماند­های پزشکی یا بهداشتی، کلیه پسماندهای  تولید شده توسط واحد­های تأمین وحفظ سلامت، مؤسسات تحقیقاتی و آزمایشگاه ها را دربر می­گیرد یا به عبارت دیگر به کلیه پسماندهای عفونی وزیان آور ناشی از بیمارستان­ها، مراکز بهداشتی ودرمانی، آزمایشگاه­های تشخیص طبی وسایر مراکز مشابه گفته می­ شود. از منابع عمده زایدات بیولوژیکی، بیمارستان­ها، آزمایشگاه­ها و مراکز تحقیقات پزشکی هستند.

طبق تعریف سازمان جهانی بهداشت، پسماندهای بیمارستانی، کلیه پسماندهای تولید شده توسط واحدهای تامین وحفظ سلامت، موسسات تحقیقاتی و آزمایشگاه­ها را در بر مسی گیرد. این تعریف حتی پسماندهای تولید شده درمنازل (مانند تزریق انسولین، دیالیز و …) را نیز شامل می­ شود(WHO, 1999).

آدرس سایت برای متن کامل پایان نامه ها

با توجه به حجم تولید بالای پسماند توسط مراکز بهداشتی- درمانی که به طور نمونه در سال 1385 به 80 تن پسماند بیمارستانی در شهر تهران به ازای هر روز رسیده و عدم استفاده از فناوری­های لازم جهت بی خطر سازی و دفن بهداشتی ،مردم و ارگان­های مرتبط را با چالشی بزرگ روبرو کرده است. همچنین پسماند­­­­های بیمارستانی به دلیل داشتن انواع‌ گوناگونی از میکروارگانیسم‌ها مانند باکتری‌های استافیلوکوک‌ و استرپتوکوک، باسیل سل و کزاز، ویروس هپاتیت(هپاتیت‌ ب و ث) و ویروس ایدز و بسیاری دیگر از میکروب­های‌ بیماریزا مخلوط­های میکروبی و عفونی جزء خطرناک­ترین پسماند­­­های جامعه شهری محسوب می­گردند‌‌‌‌(نوری، 1369).

لذا بی­­­­­­ﺗﻮﺟﻬﯽ ﺑﻪ ﻣﺪﯾﺮﯾﺖ ﺻﺤﯿﺢ ﭘﺴﻤﺎﻧﺪﻫـﺎی بیمارستانی، اﺣﺘﻤﺎل ﺑﺮوز و ﺷﯿﻮع ﺑﯿﻤﺎریﻫﺎ و اﭘﯿﺪﻣﯽﻫﺎی ﻣﻨﻄﻘه­ای وﺷﻬﺮی را اﻓﺰاﯾﺶ ﻣﯽدﻫﺪ. اﯾﻦ ﭘﺴﻤﺎﻧﺪ­ﻫﺎ ﯾﮏ ﺧﻄـﺮ ﺟـﺪی ﺑـﺮای ﺳﻼﻣﺖ ﺟﺎﻣﻌﻪ و ﻣﺤﯿﻂ زﯾﺴﺖ ﺗﻠﻘﯽ ﻣﯽﺷـﻮند(and Fabres, 1998 .( Tissat

چندین دهه است که مدیریت پسماند های بیمارستانی در دستور کار کشورهای جهان قرار گرفته است  و کشورهای پیشگام در این زمینه  به پیشرفت ها و دستاورد­های سودمندی دست یافته اند و افزون  بر تلاش برای بهبود شرایط زندگی بستری اقتصادی را نیز فراهم  ساخته اند. با وجود روش­های نوین جهت دفع پسماندهای بیمارستانی در بسیاری از مناطق کشور دفع این پسماند­های خطرناک همچنان به روش سنتی و از طریق ” دفن ” صورت می‌گیرد. دفن پسماندهای بیمارستانی، علاوه بر آلودگی‌­های زیست­محیطی و آبهای زیرزمینی، خطر گسترش برخی از بیماری­ها را در پی دارد. دفن پسماندهای بیمارستانی و عفونی به شیوه ­های کنونی در کشور می ­تواند عواقب وپیامد­­­­­های جبران ناپذیری بد­­­­نبال داشته باشد(سید محمدی، 1383).

عکس مرتبط با اقتصاد

درحال حاضر در بیشتر کشور­های دنیا دفن پسماند­های بیمارستانی به روش بی­خطر کردن و استریل کردن صورت می­گیرد و این شیوه جایگزین دفع کردن پسماند­های بیمارستانی از طریق پلاسما کردن و دستگاه زباله سوز شده است. دفن پسماندهای بیمارستانی به روش کنونی و همچنین استفاده از زباله سوز به دلیل آلودگی‌هایی که به همراه دارد به عنوان یک بحران جدی تلقی می­ شود. در زمان حاضر پسماندهای عفونی مراکزبهداشتی درمانی، مطب­ها و آزمایشگاه­های تشخیص طبی و مراکز درمانی از جمله بیمارستان­ها با پسماند‌های شهری امحاء می­گردد که بر بهداشت و سلامت مردم تاثیرگذار است. پسماندهای شهری قابل بازیافت و تبدیل به کود و قابل استفاده در سطح شهر می­باشد و به این علت مخلوط ­­­­نمودن پسماندهای شهری و بیمارستانی تهدیدی است برای بهداشت شهروندان و کارکنان بخش خدمات شهری شهرداری ­ها وسازمان­های مدیریت پسماند که با این قبیل پسماندها درتماس می­باشند. کشورهای پیشرفته و توسعه یافته پیش از این از زباله سوز و سپس از طریق پلاسما، اقدام به امحاء پسماندهای عفونی می‌کردند(Armbruster, 1998 ).

خرید تجهیزات برای بی‌خطرکردن پسماندهای بیمارستانی به روش روز دنیا، مستلزم اعتبارات زیادی است که می بایست از طرف دولت تامین گردد. مدیریت پسماندهای بیمارستانی نزدیک به پنج سال است که در ایران  به اجرا گذاشته شده و سازمان­های بهداشت و درمان،محیط زیست و شهرداری ­ها به لحاظ قانونی دست­اندر کار اجرایی آن و نظارت بر مدیریت درست آن شده ­اند(سازمان شهرداری، 1391).

عکس مرتبط با محیط زیست

1 ( Health- Care Wastes

2) World Health Organization (WHO)

موضوعات: بدون موضوع  لینک ثابت
 [ 07:59:00 ق.ظ ]




پسماندهای ویژه طبق قانون مدیریت پسماند، مصوبه 9 خرداد 1383 شامل چند گروه اصلی می­باشد. مهم‌ترین این گروه پسماندها،‌ پسماندهای بیمارستانی بوده که نقش بسزایی در به خطر انداختن سلامت شهروندان دارد. اصول درست این شیوه ها در استاندارد­های ناظر بر بهداشت محیط و حفاظت محیط ‌زیست از قبیل استاندارد EPA مربوط به ایالات متحده آمریکا و راهنمای EC مربوط به اتحادیه اروپا است. پسماندهای بیمارستانی شامل عفونی، پاتولوژیک، اجسام تیزوبرنده، دارویی، سرطان‌زا، شیمیایی، رادیواکتیو، براساس برآوردهای سازمان جهانی بهداشت در صورت تفکیک مناسب پسماندها، پسماندها شامل 80 درصد پسماندهای عادی مراکز درمانی، 15 درصد پسماندهای پاتولوژیکی و عفونی، یک درصد اجسام تیزوبرنده، سه درصد پسماندهای شیمیایی و دارویی و کمتر از یک درصد پسماندها مخصوص مواد رادیواکتیو، کپسول‌های گاز، دماسنج‌های جیوه‌ای شکسته و باطری‌های استفاده شده می­باشد. شیوه ­های از بین بردن پسماندها  شامل سوزاندن به وسیله زباله ‌سوز، ضدعفونی شیمیایی، عملیات حرارتی مرطوب، عملیات حرارتی خشک، استفاده از امواج میکروویو، دفن کردن یا انباشته‌سازی و بی‌حرکت سازی است.

درحال حاضر بیمارستان­ها بیشترین مقدار پسماندهای خطرناک را تولید می­ کنند. میزان تولید پسماندها، وابسته به عوامل زیادی  همانند درآمد سرانه و استاندارد­های بهداشتی کشور­ها­­­ست بر پایه همین امر، در کشورهای با درآمد متوسط و کم، تولید پسماند کمتر از کشور­هایی است که درآمد سرانه آنها بالا­تر است. در مراکز درمانی که طرح مدیریت تفکیک اجزاء پسماند در آنها اجرا می‌شود، میزان پسماندهای خطرناک تولیدی، نسبت به مراکز درمانی که فاقد مدیریت تفکیک پسماندها هستند، بسیار کمتر است. شوربختانه به دلیل نهادینه نشدن فرهنگ تفکیک اجزاء پسماند در مبداء تولید و عدم درک این مسئولیت توسط مدیران مراکز درمانی، میزان تولید پسماندهای بیمارستانی در کشورمان، رقم بسیار بالایی بوده به طوری که در سال‌های اخیر با توجه به رشد فزاینده آن، ‌شهر­های بزرگ کشور را دچار بحران نموده است(شجاعی، 1383).

بر پایه طرح سازمان جهانی بهداشت پسماندهای عفونی، پاتولوژیکی و اجسام تیزوبرنده با روش های مختلف زباله ‌سوزی از بین می‌روند و ضدعفونی شیمیایی پسماندها، روش میکروویو ، دفن کردن و تخلیه در فاضلاب‌ها برای پسماندهای سرطان‌زا، شیمیایی و رادیواکتیو انجام نمی‌شود. در این میان به جز روش دفن کردن و تخلیه در فاضلاب، تمامی روش‌های یاد شده برای از بین بردن اجسام تیزوبرنده استفاده می‌شود. معضل اساسی در زمینه پسماند های بیمارستانی مدیریت آن در مبداء، نحوه جمع آوری و حمل و دفع نهایی  آن می باشد.  باتوجه به اینکه معضل اصلی در مورد پسماند های بیمارستانی عدم تفکیک اجزای آن­ها در مبداء تولید می­باشد که با پا­­فشاری  و پیگیری­های وزارت بهداشت تعداد کمی از بیمارستان­ها، آن هم به صورت نامناسب و غیر بهداشتی عمل تفکیک را انجام می­ دهند. گرچه مجلس جمع آوری حمل و دفع پسماند­­های بیمارستانی را به عهده خود تولید­کنندگان(بیمارستان­ها) گذاشته است، اما تا هنگامی که بیمارستان­ها ومراکز درمانی به تنهایی و رأساً با بستن قرارداد با شرکت­های خصوصی این کار را انجام ندهند، شهرداری خود را مؤظف می­داند که نسبت به جمع آوری و دفع آن اقدام نماید. با این حال برخی از بیمارستان­ها طرح تفکیک اجزاء پسماند را به طور کامل وصحیح انجام نمی­دهند و پسماند­های عفونی و عادی را با هم جمع­آوری و بسته­بندی می­نمایند . این اقدام حجم کار و هزینه دفع پسماند را بسیار بالا می­برد، چون سازمان­های مدیریت پسماند از تفکیک پسماند­های عفونی از عادی اطمینان ندارند به ناچار همه پسماند­های بیمارستانی را عفونی تلقی می­نمایند(WHO,  2001).

موضوعات: بدون موضوع  لینک ثابت
 [ 07:58:00 ق.ظ ]




تعاریف پسماند­های مراکز بهداشتی- درمانی

همچنین انجمن خدمات آمبولانس انگلستان، پسماند های بیمارستانی به عنوان، هر پسماندی که شامل تمام یا قسمتی از بافت انسانی یا حیوانی، خون یا سایر مایعات بدن، مواد مخدر و یا سایر محصولات دارویی، سوزن آلوده یا سایر وسایل تیز، پسماند تعریف کرده است که ممکن است به هر فرد در تماس با هر گونه ضایعات ناشی از پزشکی، پرستاری، دندانپزشکی، دامپزشکی، داروسازی و یا دیگر عمل مشابه مواد زائد عفونت را به هر فرد دیگری که در تماس با آن می باشد انتقال دهد.

براساس تحقیقات انجام شده توسط سازمان بهداشت جهانیبین ۷۵ تا ۹۵ درصد پسماندهای تولید شده در واحدهای بیمارستانی بی خطر یا عمومی هستند که عمدتا از فعالیت­های اداری و خانه­داری این واحدها حاصل می شوند. 10 تا ۲۵ درصد باقی مانده خطرناک در نظر گرفته می­ شود و می­توان خطرات زیادی را به همراه داشته باشند(WHO, 2001).

پایان نامه

6 انواع طبقه بندی پسماند های بیمارستانی

هنوز در دنیا الگوی ثابتی جهت تقسیم بندی مواد زائد بیمارستانی وجود ندارد. کشورهای مختلف هر یک به گونه ای پسماندهای بیمارستانی را تقسیم بندی کرده اند. این تقسیم بندی ها بر سه اصل اساسی استوار است:

- تقسیم بندی بر اساس روش دفع(مانند کشور آلمان)

- تقسیم بندی بر اساس منبع تولید(مانند کشور فرانسه)

- تقسیم بندی بر اساس درجه احتمال خطر(مانند کشور انگلستان)

با توجه به مرکز پیشگیری و کنترل بیماری، پنج نوع پسماند بیمارستانی را عفونی تلقی می کنند: پسماند­­های میکروبیولوژیک، پاتولوژیک، لاشه حیوانات آلوده، خون واشیاء نوک تیز همچنین این مرکز  به طور کلی پسماند­های تولید شـده در مراکز درمانی به دو دسته پسماند­­­­های مشمول قانون و زباله­های معمولی  تقسیم می­شوند که حدود 6% پسماند های بیمارستانی، عفونی محسوب می شوند هرچند که  در تعاریف دیگر این مقدار را حداقل 46٪ برآورد کرده اند)عباسلو و همکاران، 1384).

اتحادیه اروپا تلاش های ویژه ای برای طبقه بندی مواد زائد را از طریق کاتالوگ پسماند اروپا انجام داده است که در این نوع طبقه بندی هفت گروه دیده می شوند(Alvim,  2005).

1-پسماندهای پاتولوژیک  ‌

ایـن پسماندها شامل بافت ها و قسمت­ های اعضاء  مختلف بدن  پنبه­های آغشته به خون و مواد دفعی بدن و چرک همچون نمونه های مدفوع و ادرار و غیره هستند که در عمل نمونه برداری یا کالبد شکافی وجراحی ایجاد می شوند. این زائدات به طور بالقوه ای امکان ایجاد بیماری را داشته و عامل بیماری زا در آن ها بسیار زیاد است وآن را برای احتیاط به عنوان پسماند­­­های عفونی در نظر گرفته می شوند.

1) UK  Emergency Medical Services (EMS)

1) Centers for Disease Control and Prevention (CDC)

2) European Union (EU)

3) Pathological waste

موضوعات: بدون موضوع  لینک ثابت
 [ 07:56:00 ق.ظ ]




انواع طبقه بندی پسماند های بیمارستانی

هنوز در دنیا الگوی ثابتی جهت تقسیم بندی مواد زائد بیمارستانی وجود ندارد. کشورهای مختلف هر یک به گونه ای پسماندهای بیمارستانی را تقسیم بندی کرده اند. این تقسیم بندی ها بر سه اصل اساسی استوار است:

- تقسیم بندی بر اساس روش دفع(مانند کشور آلمان)

- تقسیم بندی بر اساس منبع تولید(مانند کشور فرانسه)

- تقسیم بندی بر اساس درجه احتمال خطر(مانند کشور انگلستان)

با توجه به مرکز پیشگیری و کنترل بیماری، پنج نوع پسماند بیمارستانی را عفونی تلقی می کنند: پسماند­­های میکروبیولوژیک، پاتولوژیک، لاشه حیوانات آلوده، خون واشیاء نوک تیز همچنین این مرکز  به طور کلی پسماند­های تولید شـده در مراکز درمانی به دو دسته پسماند­­­­های مشمول قانون و زباله­های معمولی  تقسیم می­شوند که حدود 6% پسماند های بیمارستانی، عفونی محسوب می شوند هرچند که  در تعاریف دیگر این مقدار را حداقل 46٪ برآورد کرده اند)عباسلو و همکاران، 1384).

اتحادیه اروپا تلاش های ویژه ای برای طبقه بندی مواد زائد را از طریق کاتالوگ پسماند اروپا انجام داده است که در این نوع طبقه بندی هفت گروه دیده می شوند(Alvim,  2005).

1-پسماندهای پاتولوژیک  ‌

ایـن پسماندها شامل بافت ها و قسمت­ های اعضاء  مختلف بدن  پنبه­های آغشته به خون و مواد دفعی بدن و چرک همچون نمونه های مدفوع و ادرار و غیره هستند که در عمل نمونه برداری یا کالبد شکافی وجراحی ایجاد می شوند. این زائدات به طور بالقوه ای امکان ایجاد بیماری را داشته و عامل بیماری زا در آن ها بسیار زیاد است وآن را برای احتیاط به عنوان پسماند­­­های عفونی در نظر گرفته می شوند.

2-پسماند­های رادیو اکتیو

این پسماند­ها شامل پسماند­های جامد، مایع و گازی آلـوده بـه مـواد رادیـو اکـتـیـو هستند. کاربرد مواد رادیواکتیو در عکسبرداری ها، پرتودرمانی­ها و بعضی آزمایش­ها معمول است. این پسماندها که در نتیجه تحلیل­های بافت و سیالات بدن در بیمارستان تولید می­شوند و مهم­ترین عناصر آن ایزوتوپ­های فسفر، کروم، کبالت، آهن، گالیم و غیره می­باشند که در تشخیص یا درمان کاربرد دارند.

پسماندهای شیمیایی

مواد زائد شیمیایی که به وفور در بیمارستان­ها وجود دارد، در بخش­های تشخیص و آزمایشگاه­ها ، وسایل و ابزار تنظیف و ضدعفونی به انضمام دارو­ها و وسایل دور ریختنی اطاق عمل بخش دیگری از این فضولات را تشکیل می دهند. این پسماندها شامل اشکال گوناگونی از پسماندهای شیمیایی بوده که ممکن است خطرناک بـاشـنـد. طبق موازین بین المللی، خصوصیات سـمــی بـودن، خـورنـدگـی، قـابـل اشـتـعـال بـودن واکنش دهندگی، سرطان­زایی باعث طبقه بندی مـواد زائد شیمیایی در زمره مواد زائد خطرناک مـی­شوند. مواد شیمیایی غیر خطرناک، موادی هـسـتـنـد کـه خصوصیات فوق را نداشته باشند.

فضولات شیمیایی خطرناک در سه بخش زیر تقسیم بندی می­شوند:

1 -مواد قابل احتراق : شامل ترکیبات جامد، مایع و گازی شکل.

2 -فضولات سمی : این فضولات با PH کمتر از 2 (به شکل اسیدی) و بالاتر از 12 (به حالت قلیایی) در پسماند های بیمارستانی وجود دارند. بخشی از داروهای اضافی و یا فاسد شده، جزو اینگونه فضولات به حساب می­آیند.

3- مواد واکنش دهنده و موثر: در سایر فضولات که تا حدودی در پسماند­های بیمارستانی قابل تشخیص هستند. از فضولات شیمیایی بی خطر می توان قندها، اسید­های آمینه و برخی از نمک­های آلی و معدنی را نام برد. اسید­های آمینه و نمک­های شیمیایی نظیر نمک­های سدیم، منیزیم، کلسیم، اسید لاکتیک، انواع اکسید­ها، کربنات­ها، سولفات­ها و فسفات­ها قسمتی از مواد زائد شیمیایی هستند

 

1) Centers for Disease Control and Prevention (CDC)

2) European Union (EU)

3) Pathological waste

4) Radioactive waste

2) Chemical waste

موضوعات: بدون موضوع  لینک ثابت
 [ 07:55:00 ق.ظ ]




پسماندهای عفونی

پسماندهای عفونی، حداقل شامل مواد زائد آزمایشگاهی، نظیر محیط­های کشت و مواد زائد بخش­های جراحی و کالبد شکافی و بخش­های ایزوله می­باشند که بیماران عفونی در آن بستری می­گردند. پسماند­هایی که از بخش­های همودیالیز بیماران به دست می­آید  مثل فیلتر­ها ولوله­ها، حوله­های یکبار مصرف ، روپوش­ها و دستکش­ها و غیره) و نیز مواد زائد حیوانات تلقیح شده در زمره این گروه زائدات قرار دارند.پسماند­های عفونی ، زائداتی هستند که قادرند حداقل یک بیماری عفونی را منتقل سازند به دلیل اینکه روش قابل قبول برای عفونی بودن این گونه زائدات در دست نیست ، مراکز قانونی اینگونه مواد را بر حسب اینکه از کجا و با چه محتویاتی تولید می شوند، شناسایی و تعریف می­ کنند. بر این اساس حداقل 3 درصد و حداکثر 90 درصد زائدات بیمارستانی را مواد زائد عفونی تشکیل می­ دهند(عمرانی ،1369).

دانلود تحقیق و پایان نامه

مرکز پیشگیری و کنترل بیماری پنج نوع پسماند بیمارستانی را عفونی تلقی می کنند که شامل پسماند­­های میکروبیولوژیک، پاتولوژیک، لاشه حیوانات آلوده، خون واشیاء نوک تیزمی باشند(اصل سلیمانی، 1379.(

یکی از کامل­ترین نظریه­ها در این خصوص توسط Liberman  ارائه شد وی پسماندهای عفونی را  در 12 نوع مشخص طبقه بندی کرده است(کریم زادگان ،1375).

1) پسماند بخش های ایزوله

بـیـمـاران ایـن بـخـش بـه دلـیـل داشتن بیماری عـفـونـی قـابـل انـتقال، از سایر بیماران مجزا شده‌اند. بدیهی است از نظر انتقال ویروس ایدز و هپاتیت B مراقبت های لازم در دفع پسماند های خونین و مایعات بدن بیماران بستری در بیمارستان­هـا و بـخـش هـای ایـزوله ضرورت کامل دارد .

2)  پسماند محیط­های کشت و دیگر عوامل عفونی

ایـن مـواد از آزمایشگاه­های تـشخیـص طـبـی‌، آزمایـشگاه­هـای پـاتـولـوژی و مـیـکـروب­شـنـاسـی و تـحـقـیـقـاتی تولید می شوند که شامل کشت های تهیه شده از نمونه های اخذ شده از بیماران است. نمونه های نگهداری شده برای تـحـقـیق و زایدات فرآورده ­های معین دارویی، قـسمت دیگری از این مواد زاید عفونی قلمداد می شوند.

3)  فرآورده ­های خونی

ایـن گـونـه زایـدات تـوسط بـانک­های خون، آزمایـشگاه­های تشخیص طبی، مراکز دیالیز و شرکت­های دارویی تولید می­شوند. این مواد به طـور بالقوه عفونی بوده و امکان وجود عوامل بـیماری­زا در آن‌هـا بـسـیار زیاد است. این مواد مـمکن است  علاوه بر ویروس ایدز و هپاتیت، سایر بیماری­های قابل انتقال به وسیله خون نظیر مالاریا سرخجه مادرزادی و غیره را منتقل کنند.

4) پسماند ناشی از اعمال جراحی و کالبد شکافی

پسماند کـه در جـریـان عـمـل جـراحی و کـالـبد شکافی به دست می آید همراه با عوامل بـیـمــاری­­زا بـه عـنـوان مـواد زایـد عـفـونـی تـلـقـی مـی‌شوند. از دیدگاه مراقبت­های جهانی تمام مـواد زایـد را کـه در تـمـاس بـا خـون و جریان خـون هستـد باید به عنوان پسماند عفونی تلقی کرد.

1) Infection waste

 2) Centers for Disease Control and Prevention (CDC)

موضوعات: بدون موضوع  لینک ثابت
 [ 07:53:00 ق.ظ ]




پسماندهای آلوده آزمایشگاهی

ایـــن دسـتـه از پسماندها، ظــروف کـشــت و وسـایـلـی را  که برای تهیه محیط کشت و انتقال آن‌ ها به کار می­رود شامل می­شوند. بدیهی است پـارچـه­هـایـی که در تماس با محیط­های کشت هستند نیز آلوده هستند. در هر صورت مواد زاید  آزمایشگاهی شامل تمام مواد زایدی هستند که در تماس با عوامل بیماری زا بوده و ممکن است حاوی کشت‌ها و نمونه‌های آزمایشگاهی آلوده باشند.

6)  وسایل آلوده نوک تیز و برنده

مثل سوزن ها و سرنگ ها، شیشه های شکسته، چاقو­های جراحی و نظایر آن­ها .

7) پسماند بخش دیالیز

این مواد زایداتی هستند که در اثر تماس با خون بیماران همو­­دیالیز به وجود آمده و شامل وسایل، و ابزار و موادی هستند که به علت مصرف در این بخش ایجاد می شوند.

تحقیق - متن کامل - پایان نامه

8) پسماند­­های آلوده بخش نگهداری حیوانات

ایـن مواد شامل لاشه و قسمت های مختلف آلوده حیواناتی است که جهت انجام آزمایش­های مختلف تحقیقاتی در معرض عوامل بیماری زا قرارمی گیرند.

9) پسماندهای بیولوژیک و دارویی

ایــن پسماندها شـامل واکسن­هـا و سایر مـواد زایـدی هستند که در جریان تـولـیـد فـرآورده‌هـای بـیولوژیک شرکت­های دارویی تولید می­شوند. این مواد به علت عدم استاندارد بودن یا گذشت تاریخ مصرف و خروج از رده به بازار، دور ریخته می­شوند. بیمارستان­ها و مراکز تحقیقاتی، بیولوژیک، کلینیک­ها، داروخانه­ها و غیره منبع اصلی مـواد زایـد بـیـولـوژیـک مـخـاطـره آمـیـز هـسـتـنـد. از جـمـلـه خـصـوصـیـات مـهـم مواد زاید بیولوژیک، قدرت آلوده سازی، عفونت زایی و ایجاد مسمومیت برای موجودات زنده است. مواد زایدی که در این گروه قرار می گیرند عبارتند از : بافت­های بدخیم حاصل از جراحی، مواد آلوده مثل سوزن­ها، باند­­ها و… مواد زاید بـیولوژیک به عنوان محصول فرعی حاصل از فرایند­های بیولوژیک یک کارخانه نیز می‌تواند باشد.

10) پسماند غذایی وسایر فرآورده های آلوده

این مواد زاید شامل مواد غذایی آلوده(پس مانده غذایی بیماران عفونی)، داروها و مواد بهداشتی که آلوده و غیر قابل مصرف تشخیص داده شده اند، هستند .

11) لوازم و ابزار آلوده

وسـایـلـی که در آزمایشگاه های پزشکی و میکروبیولوژی و تحقیقاتی که با عوامل عفونی در تماس بوده و در تولید وآزمایش فرآورده ­های دارویی، آلوده  می­شوند در این گروه قرار می­گیرند. اگر قرار است این وسایل ضد عفونی شده و مجدداً مورد استفاده قرار گیرند، دقت لازم در خصوص رفع آلودگی از آن­ها ضروری است .

موضوعات: بدون موضوع  لینک ثابت
 [ 07:52:00 ق.ظ ]




  • پسماندهای ژنوتوکسیک

پسماندهای ژنوتوکسیک به شدت خطرناک هستند و ممکن است خصوصیات ایجاد جهش سلولی و سرطان زایی داشته باشند. این پسماندها مشکلات ایمنی جدی به وجود می‌آورند. این مشکلات هم درون بیمـارستان و هم پس از دفع پسماندها در بیرون از بیمارستان می‌تواند وجود داشته باشد و باید مورد توجه خاص قرار داشته ‌باشند. آن­ها می‌توانند دارای دارو­های سایتوتوکسیک معین، سایتوتوکسیک، مواد شیمیایی و مواد پرتوساز باشند، داروهای سایتوتوکسیک که مواد اصلی این مقوله را تشکیل می‌دهند، می‌توانند بعضی سلول­های زنده را بشکند یا رشد آنها را متوقف کنند. این داروها برای شیمی درمانی سرطان­ها به کار می‌روند. دارو­های سایتوتوکسیک بیشتر اوقات در بخش­های تخصصی مانند بخش سرطانی شناسی و واحدهای پرتو درمانی مصرف می‌شوند، که نقش اصلی آنها درمان سرطان است(WHO, 2005).

  • پسماندهای محتوی فلزات سنگین

پسماندهای محتوی فلزات سنگین یک زیر رده از پسماند­­های شیمیایی خطرناک و به طور معمول به شدت سمی‌اند. پسماندهای دارای جیوه به طور مشخص از نشت تجهیزات شکسته شده بالینی به وجود می‌آیند. جیوه‌های پخش شده از چنین دستگاه­هایی تا حد ممکن باید جمع‌ آوری شوند. پسماندهای دارای کادمیوم عمدتاً از باتری‌های دورریخته و شکسته به وجود می‌آیند. برخی « پانل‌های تقویت شده با چوب» با مقداری سرب هنوز هم به عنوان ضد نفوذ کردن پرتوهای X و در بخشهای تشخیصی به کار می‌روند(WHO, 1999).

شایان ذکر است که در یک تـقـسـیـــم بــنـــدی متداول در آسیا، مـــواد زایـــد ویـــژه بیمارستانی شامل  6‌گروه زیر هستند:

1) مـواد زائد آنـاتـومـیـک، شامل مواد زاید اطـاق عـمـل، مـواد زایـد اطـاق زایـمـان، اعـضاء و  اندام­های قطع شده، جنین مرده و جفت و مواد آناتومیک ناشی از جراحی­های سطحی است .
2) مــواد زائد بـیــولــوژیــک حــاصـل از تـمـام بخش‌ها شامل:
الف)  پارچه های آغشته به الکل و اتر و خون.
ب) اجــســـام یـــک بـــار مــصــرف فـلــزی ، نـظـیــر سرنگ، سوزن های تزریق زیر جلدی، تیغه های چاقوی جراحی، اجسام پلاستیکی مثل ظروف ادرار، لـــولـــه­هـــای پلاستیکی، بطری­های پلاستیکی ، سرنگ و ماسک و دستکش.
بـسـتـه بـنـدی مـثـل ظـروف شـیشه­ای سرم خون ، بطری های شیشه داروها، انواع آمپول ها، کارتون کاغذ و جعبه‌های دارو .
3)‌ مواد زائد ویژه مثل : فیلترهای دیالیز کلیه، گچ شکسته بندی و قالب گیری .
4) ‌مواد زائد بخش رادیولوژی، آزمایشگاه‌های شیمیایی و باکتریولوژی

5)‌ مواد زائد رادیو اکتیو.
و ) ‌مواد زائد دارویی(دریاباری،1379 ).

1) Genotoxic Waste

2) Heavy Metals Waste

موضوعات: بدون موضوع  لینک ثابت
 [ 07:50:00 ق.ظ ]




مخاطرات بهداشتی پسماند های بیمارستانی

در چند دهه گذشته،  فعالیت های بشر و تغییرات مرتبط با شیوه زندگی و الگو­های مصرف، انواع مختلفی از پسماند­ها را تشکیل شده است که بقای انسان­ها و موجودات زنده دیگر و همچنین منابع طبیعی  را تهدید کرده است(Oweis et al, 2005).

قابل توجه است که مواد زائد پزشکی حاصل از فعالیت­های بهداشتی درمانی بوده و در زمره مواد زائد خطرناک هستند که دربیمارستان­ها، درمانگاه ها، کلینیک­ها و مراکز تحقیقات و دارویی تولید می­شوند و بخش مهمی از مواد زائد جامد شهری هر جامعه­ای را تشکیل می­ دهند که به علت دارا بودن انواع گوناگون میکروارگانیسم ها مانند باکتری­ های استافیلوکوک، باسیل، سل، کزاز، ویروس هپاتیت و ایدز از نظر بهداشتی بسیار حایز اهمیت هستند(Geadon, 1994).

این درحالی است که تخمین نشان می‌‌دهد که حدود ۵/۲ میلیون نفر)شامل ۴ میلیون کودک( هر ساله از بیماری‌های مربوط به پسماند جان خود را از دست دادند .(Akter, 2000)

پایان نامه - تحقیق

لذا مخاطرات بالقوه بهداشتی و آلودگی های مواد زائد پزشکی را می توان بصورت زیر طبقه بندی نمود:

  • مخاطرات بهداشتی و شغلی :

افراد و گروه هایی که بیشتر در معرض خطر می باشند شامل بیماران و پرسنل و کارگران مسئول جمع آوری و حمل و دفع پسماند بیمارستانی و سایر افرادی که به نحوی در تماس با این گونه پسماندها قرار دارند. پسماندهای پزشکی از بخش بزرگی ازپسماندهای عفونی، که بطور بالقوه خطرناک است تشکیل شده اند که ممکن است حاوی عوامل بیماری زا باشند. برخی از ارگانیسم های بیماری زا می توانند خطرناک باشد، چرا که آنها ممکن است مقاوم در برابر درمان بیماری ها شوند. جمع آوری و دفع نا­مناسب از این ضایعات به طور مستقیم و غیر مستقیم می توانند خطرات جبران ناپذیری بر بهداشت عمومی و محیط زیست وارد کنند(Abdullah et al, 2008).

عکس مرتبط با محیط زیست

  • مخاطرات زیست محیطی و زیبا شناختی :

پسماند­های بیمارستانی در صورتی که به درستی دفع نشوند، نوعی تهدید جدی برای سلامت افراد جامعه می باشند. اغلب موارد، بسیاری از پسماند­های دفع شده بیمارستانی به عنوان عوامل بیماری زا محسوب می­شوند و اگر به درستی دفع نشوند، زمین و آب آن منطقه را آلوده می­ کنند و ممکن است هر نوع محصول کشاورزی که از آن زمین به عمل  می­آید نیز تحت تاثیر این آلودگی قرار بگیرد و محصولات آلوده و نامرغوبی به بار دهد. پسماند­های بیمارستانی غیر بهداشتی دفع شده، پس از مدتی می توانند(از طریق آب و هوا و خاک) خود را به بافت­های موجودات زنده و حیوانات و یا انسان­های دیگر برسانند. اگر دستگاه ایمنی آن فرد سالم باشد، مشکل خاصی برایش رخ نمی دهد، اما اگر دستگاه ایمنی او بر اثر ابتلا به انواع بیماری­ها ضعیف شده باشد، به بیماری­های مختلف مبتلا می شود .(Baraka et al, 2006)

    • مخاطرات اجتماعی ، اقتصادی ، سیاسی :

 تصویر درباره جامعه شناسی و علوم اجتماعی

قابل توجه است هرگونه اختلال در مدیریت و امحای پسماندهای پزشکی، منجر به بروز انواع بیماری­ها و عفونت­های مختلف و آلودگی محیط زیست خواهد شد و انسان و محیط زیست قربانیان مدیریت ناصحیح پسماند­های پزشکی می باشند. از سوی دیگر باید به این نکته توجه داشت که شیرابه هرگونه پسماندی از جمله پسماندهای پزشکی در زمین فرو می رود و وارد آب­های زیر زمینی می­ شود. بنابراین لازم است استاندارد­ترین و به روز­­­ترین روش­ها از کم کردن حجم پسماند­ها از طریق جداسازی پسماند­های بیمارستان­ها به پسماند­­های اداری و عفونی و همچنین استفاده از پسماند سوزهای مرکزی به کار گرفته شود تا پسماندهای پزشکی به طور کامل و با روشی مورد تایید کارشناسان بهداشتی، امحا شوند.بی تردید هر گونه مدیریت ضعیف در زمینه مراقبت های بهداشتی انتقال آلودگی از پسماندهای پزشکی، تمام کارکنان مراکز درمانی، بیماران، دست اندرکاران در حمل و نقل پسماند و کل جامعه را در معرض عفونت­ها و اثرات سمی و همچنین آلودگی­های زیست محیطی ناشی از آن قرار می­دهد(Philip, 2003).

 

موضوعات: بدون موضوع  لینک ثابت
 [ 07:49:00 ق.ظ ]




مدیریت پسماند بیمارستانی و لزوم توجه به آن

مفهوم کلی مدیریت زائدات در بیمارستان ها در مجموع شامل آموزش همگانی ، کاهش تولید، ذخیره سازی، جمع آوری، حمل و نقل، پردازش و دفع اینگونه زائدات درچارچوب ملاحظات سیاسی، اقتصادی، اجتماعی، فرهنگی و فنی بوده و وجود قوانین مدون و کارآمد درجامعه می تواند ضمن تاثیر مثبت در کاهش تولید اینگونه زائدات، موجبات افزایش بهره وری ملی و نیز کاهش اثرات نامطلوب ناشی از دفع غیر اصولی زائدات بر بهداشت عمومی و محیط زیست جامعه را نیز به همراه داشته باشد(Garving,1995).

به طور کلی مدیریت صحیح پسماندهای بیمارستانی از لحاظ زیست محیطی دارای اهمیت فراوان می­باشد و چنانچه مدیریت پسماندهای بیمارستانی به درستی صورت نگیرد، علاوه بر تأثیرات سوء بهداشتی، بر فعالیت های اصلی بیمارستان تأثیر گذارخواهد بود و برای محیط زیست نیز اثرات سوء در بر خواهد داشت. رهنمود­­­­­های مدیریت مواد زائد بیمارستانی نه تنها در به حداقل رساندن خطرات مطرح برای کارمندان در تمامی سطوح کمک می کنند، بلکه خطرات بالقوه محیط زیست را نیز کاهش می­دهد)عمرانی,1384(.

عکس مرتبط با محیط زیست

شایان ذکر است که مدیریت پسماندهای بیمارستانی به ترتیب شامل به حداقل رساندن زائدات و بازیافت، ضدعفونی باکلیه روش ها، سوزاندن، خنثی سازی،  دفن بهداشتی و دفع در شبکه فاضلاب شهری است.(Acharya and Singh, 2000)

به طور کلی، عناصر کلیدی برای یک برنامه موثر مدیریت مواد زائد پزشکی باید شامل موارد زیر باشد (شکل1-3):

  • طرح مدیریت پسماند
  • شناسایی انوع پسماندها
  • جداسازی پسماند، مهار و برچسب زدن
  • ذخیره سازی
  • حمل و نقل(در سایت و خارج از سایت)
  • درمان
  • دفع مناسب پسماند
  • نگهداری سوابق مدیریتی پسماند
  • آموزش ادواری کارکنان به منظور روزآمد کردن دانش آنها

 

طرح مدیریت پسماند باید شامل موارد ذیل باشد :

  • انطباقبا مقررات مربوطه (پیوست 1 قانون مدیریت پسماندها)
  • مسئولیت پذیری همه کارکنان درگیر (به عنوان مثال،  کنترل عفونت ها،
  • کنترل محیط زیست و پرسنل خانه داری، بخش و مسئولیت فردی)
  • تعریف و شناخت صحیحی از تمام پسماند های پزشکی به کار گرفته شده در داخل یک مرکز
  • اجرای پروسه مراحل مدیریت گام به گام در مرکز مربوطه
موضوعات: بدون موضوع  لینک ثابت
 [ 07:48:00 ق.ظ ]




تفکیک پسماند های بیمارستانی

 یکی از اهداف مهم طرح تفکیک پسماند­­­­­های بیمارستانی تامین سلامت کارکنان شاغل در بیمارستان می­باشد. به طور کلی، پسماند بیمارستانی از پسماندهای عمومی در نقطه مبدا توسط ژنراتورها در ظروف مشخص شده، بسته به نوع پسماند تفکیک می­شوند. برای مهار هزینه ها، کارکنان مرکز باید به طور خاص جدا­­سازی پسماند­­های بیمارستانی را آموزش ببینند. لذا تفکیک باید در منبع انجام شود(Tsakona & Anagnostopoulou, 2006).

به طور کلی در بیشتر کشورهای پیشرفته، پسماندهای بیمارستانی پیش از دفع، تفکیک می­شوند، به طوری که هم اکنون در این کشورها فقط 15 درصد پسماندهای بیمارستانی، خطرناک هستند اما درکشور ما به سبب تفکیک نشدن صحیح و اصولی پسماندها، حدود 70 درصد پسماندهای خروجی مراکز درمانی خطرناک هستند. درصورت رعایت قوانین و آیین نامه ها و توجه به جداسازی و تفکیک پسماندهای بیمارستانی، تنها 20 درصد از کل پسماندها، خطرناک خواهند بود. نوع بیمارستان در میزان پسماند تولیدی آن بسیار مؤثر می باشد به طوری که در بیمارستان های آموزشی این مقدار تقریباً  1.5برابر بیمارستان های عمومی می باشد(موسوی، 1384).

دانلود تحقیق و پایان نامه

لذا اگر تفکیک پسماند به درستی انجام پذیرد در بدترین شرایط تنها 5% از پسماندهای بهداشتی درمانی باید از بین برود. بقیه مواد سیر عادی زنجیر بازیافت یا تبدیل به مواد دیگر را طی خواهد کرد(خرا شادی، 1386).

لازم به ذکر است پسماند های نوک تیز و برنده صرف نظر از اینکه آلودگی داشته یا نداشته باشد در جعبه یا محفظه مقاوم  مخصوص جمع آوری گردد. ظروف جمع آوری این اجسام باید ضد سوراخ شدن بوده و در پوش مناسب داشته باشد و جنس این ظروف به قدری سخت و نشت ناپذیر باشد که نه فقط اجسام برنده و نوک تیز بلکه هر گونه بقایای آبگونه های موجود در سرنگ ها را در خود نگه دارد. لازم است به‌ منظور پیشگیری از جراحات ناشی از وسایل تیز و برنده ظروف جمع‌ آوری ایمن به تعداد کافی و با ابعاد گوناگون در دسترس ارائه دهنده خدمت در کلیه واحدهای ذیربط قرار داشته باشد. کلیه سر سوزن­ها از سرنگ­های مصرف شده(به خصوص در موارد شیمی در مانی) جدا نشود و بصورت توام جمع آوری گردد. استفاده از برچسب هشداردهنده بر روی ظروف جمع‌ آوری با مضمون « احتمال آلودگی با اشیاء تیز و برنده عفونی »‌ به ‌منظور جلب توجه کارکنان بهداشتی درمانی الزامی است)جدول شماره1-2). این درحالی است که پسماندهای پرتوزا و رادیو اکتیو، برابر ضوابطی که به اتفاق وزارت بهداشت، درمان و آموزش پزشکی وسازمان انرژی اتمی تهیه واعلام خواهد شد، زیر نظر مسئول فیزیک بهداشت مدیریت خواهد شد. پسماند های معمولی یا شبه خانگی بایستی در کیسه پسماند مقاوم مشکی رنگ جمع آوری ودر مخزن آبی رنگ قابل شستشو و ضد عفونی نگهداری شود(WHO, 2002).  در واقع به منظور پیشگیری از سرریز شدن وسایل دفعی، درصورتی که حداکثر سه چهارم حجم ظروف مزبور پرشده باشد ضروری است درب ظروف به نحو مناسبی بسته شده و دفع شوند. ماده سازنده ظروف و کیسه‌ پلاستیکی نباید از پلاستیک‌‌های قابل احتراق و غیرهالوژنه باشد،کیسه‌های پلاستیکی نباید با منگنه بسته شوند،کیسه‌های حاوی ابزار پزشکی نوک تیز باید به رنگ زرد و برچسب گذاری شده باشد، جمع‌ آوری پسماند‌ها باید روزانه صورت گرفته و به مراکز انبار منتقل شوند، هیچ کیسه‌ای نباید بدون برچسب گذاری انتقال یابد، بلافاصله باید کیسه‌های جدیدی در محل سطل پسماند قرار داده شود.همچنین هیچ کیسه محتوی پسماند نباید بدون داشتن برچسب وتعیین نوع محتوای کیسه از محل تولید خارج شود. برچسب باید دارای مشخصاتی از قبیل(تاریخ تولید، نام بخش، نوع پسماند و غیرباشد…زارت بهداشت، درمان و آموزش پزشکی ,1386).

موضوعات: بدون موضوع  لینک ثابت
 [ 07:46:00 ق.ظ ]




نگهداری موقت پسماند های بیمارستانی

جایگاه ذخیره سازی موقت پسماند مکانی مناسب جهت نگهداری پسماند ها در داخل بیمارستان در فضایی جداگانه متناسب با مقدار و تناوب جمع آوری آن ها باید تعیین گردد، همچنین محل ذخیره ونگهداری موقت باید باتوجه به مقدار پسماند جمع‌ آوری شده، دوره زمانی جمع‌ آوری، اندازه ساختمان و اتاق‌ها طراحی شود(Williams, 2005). محل ذخیره سازی به سه قسمت مجزا، محل ذخیره زائدات عفونی، محل ذخیره زائدات تیز و برنده و محل ذخیره زائدات دارویی و شیمیایی  خطرناک تقسیم شوند. شایان ذکر است که پسماند‌های سیتوتوکسیک باید جدا از سایر پسماند‌های بیمارستانی و در یک محل ایمن و مطمئن ذخیره شوند و پسماند‌های رادیواکتیو نیز در ظروف دارای پوشش سربی نگهداری شده و جزییات مربوط به آنها روی ظروف برچسب زده شوند. در مواردی که درمحل موقت نگهداری، سردخانه وجود داشته باشد، مدت انباشتن پسماندها(یعنی فاصله بین تولید و تصفیه یا دفع نهایی آن) درمنا طق معتدل 72 ساعت در زمستان و 48 ساعت در تابستان، درمناطق گرم 48 ساعت در زمستان و 24 ساعت در تابستان نباید بیشتر شود(وزارت بهداشت، درمان و آموزش پزشکی ,1386 ).

لازم به ذکر است محل نگهداری موقت پسماند باید شرایط زیر را دارا باشد:

P  دارای کف نشت نا پذیر ومحکم دارای امکانات تخلیه وزهکشی خوب باشد ونظافت وگندزدایی آن به آسانی و بصورت مستمر انجام گردد همچنین سیستم آب گرم و سرد برای تمیز کردن محل داشته باشد و به‌ آسانی در دسترس کارکنان شاغل در کارهای مربوط به پسماند ها بوده وارتباط مناسب با ب خش ها داشته باشد .

Pامکان قفل کردن ورودی آن به منظور جلوگیری از دستیابی اشخاص غیر مجاز فراهم باشد و وسیله نقلیه گرد آوری پسماندها به راحتی به محل ذخیره دسترسی داشته باشد .

P در مقابل تابش آفتاب دسترسی جانوران، حشرات و پرندگان حفاظت داشته باشد و حداقل دارای تهویه باشد.

P نباید درجایی نزدیک به انبار مواد غذائی تازه یا محل آشپزخانه باشد.

P تجهیزات تمیز کاری ، لباس حفاظتی ، کیسه پسماند وظروف گرد آوری پسماند فراهم شود و نزدیک به منطقه ذخیره که با دسترسی آسان موجود باشد.

P جهت نگهداری انواع پسماند بیمارستانی قسمت بندی وعلامت گذاری شود.

P تحت نظارت بهداشتی وایمنی کافی قرار داشته باشد.

P محل مورد نظر باید محصور، مسقف وبه وسیله علامت یا تابلوی مخصوص هشدار دهنده مشخص شده باشد(وزارت بهداشت، درمان و آموزش پزشکی ,1386).

 

1-8-3  بازیافت و دفع  پسماند های بیمارستانی

در ایران با توجه به کیفیت پسماند های شهری که بهره وری بازیافت و کودسازی در آنها زیاد است و نیز با عنایت به وجود زمین های بایر و فراوانی که در اطراف شهرها تناسب خاصی برای دفن بهداشتی پسماند دارند، سرمایه گذاری در جهت احداث کارخانه های زباله سوز، توصیه نمی شود اما از آنجا که آلودگی بیولوژیکی و عفونی پسماند های بیمارستانی معمولاً بیش از انواع دیگر پسماند است  کارشناسان بهترین روش را برای دفع پسماند  های مراکز درمانی را سوزاندن در کوره های پسماند سوز ،توصیه کرده اند. محاسن و معایب سوزاندن پسماند با دستگاه های زباله سوز به شرح زیر خلاصه می شود(عمرانی،1377) :

Efficiency بهره وری

  • محاسن :

P این روش موثرترین روش دفع پسماند است که در مقایسه با سایر روش های دفع به زمین کمتری نیاز دارد.

دانلود پایان نامه

P خاکستر باقیمانده به علت عاری بودن از مواد آلی و باکتری ها از نظر بهداشتی مخاطره آمیز نبوده و قابل دفن است.

Pآب و هوا و تغییرات جوی تقریباً تاثیر مهمی دراین روش ندارد.

P  سوزاندن پسماند در دستگاه های زباله سوز منافع جنبی نظیر استفاده از حرارت ایجاد شده برای گرم کردن بویلرها و در نتیجه تولید انرژی بهره دارد .

  • معایب:
  • این روش در مقایسه با سایر روش ها به سرمایه گذاری و هزینه اولیه بیشتری نیاز دارد.
  • این روش ایجاد بو،دود وآلودگی هوا می نماید که عموماً مورد اعتراض مردم است.
  • به پرسنل کارآزموده و افراد مجرب برای بهره برداری و نگهداری از دستگاه های زباله سوز نیاز است.
  • هزینه نگهداری و تعمیرات در این روش بیش از سایر روش های پسماند است.
  • این روش برای دفع مواد زاید خطرناک نظیر مواد رادیواکتیو و مواد قابل انفجار روش مناسبی نیست.
موضوعات: بدون موضوع  لینک ثابت
 [ 07:45:00 ق.ظ ]




بازیافت و دفع  پسماند های بیمارستانی

در ایران با توجه به کیفیت پسماند های شهری که بهره وری بازیافت و کودسازی در آنها زیاد است و نیز با عنایت به وجود زمین های بایر و فراوانی که در اطراف شهرها تناسب خاصی برای دفن بهداشتی پسماند دارند، سرمایه گذاری در جهت احداث کارخانه های زباله سوز، توصیه نمی شود اما از آنجا که آلودگی بیولوژیکی و عفونی پسماند های بیمارستانی معمولاً بیش از انواع دیگر پسماند است  کارشناسان بهترین روش را برای دفع پسماند  های مراکز درمانی را سوزاندن در کوره های پسماند سوز ،توصیه کرده اند. محاسن و معایب سوزاندن پسماند با دستگاه های زباله سوز به شرح زیر خلاصه می شود(عمرانی،1377) :

Efficiency بهره وری

  • محاسن :

P این روش موثرترین روش دفع پسماند است که در مقایسه با سایر روش های دفع به زمین کمتری نیاز دارد.

دانلود پایان نامه

P خاکستر باقیمانده به علت عاری بودن از مواد آلی و باکتری ها از نظر بهداشتی مخاطره آمیز نبوده و قابل دفن است.

Pآب و هوا و تغییرات جوی تقریباً تاثیر مهمی دراین روش ندارد.

P  سوزاندن پسماند در دستگاه های زباله سوز منافع جنبی نظیر استفاده از حرارت ایجاد شده برای گرم کردن بویلرها و در نتیجه تولید انرژی بهره دارد .

  • معایب:
  • این روش در مقایسه با سایر روش ها به سرمایه گذاری و هزینه اولیه بیشتری نیاز دارد.
  • این روش ایجاد بو،دود وآلودگی هوا می نماید که عموماً مورد اعتراض مردم است.
  • به پرسنل کارآزموده و افراد مجرب برای بهره برداری و نگهداری از دستگاه های زباله سوز نیاز است.
  • هزینه نگهداری و تعمیرات در این روش بیش از سایر روش های پسماند است.
  • این روش برای دفع مواد زاید خطرناک نظیر مواد رادیواکتیو و مواد قابل انفجار روش مناسبی نیست.

قابل ذکر است که در حال حاضر بازیافت از پسماند های بیمارستانی و مراکز بهداشتی به علت اختلاط آلودگی با مواد قابل بازیافت  ممنوع می باشد.

جدول 1-3 : روش های دفع انواع پسماندهای بیمارستانی(.(WHO, 1999

پسماندهای رادیو اکتیو

 

پسماندهای شیمیایی

 

پسماندهای ژنوتوکسیک پسماندهای دارویی وسایل آلوده نوک تیز و برنده

پسماندهای

تشریحی

پسماندهای عفونی فناوری
×  ×  ×  ×  ü ×  ü (اتو کلاو)
× × × × × × ü ماکروویو
در مقادیر کم ×  ×  ×  ü ü ü زباله سوز تک اتاقه
×  ×  ×  ×  ü ü ü زباله سوز دو اتاقه
در مقادیر کم در مقادیر کم ×  در مقادیر کم ü ü ü زباله سوز پیرولیتیک

× 

 

در مقادیر کم در مقادیر کم ü ü ×  ×  محفظه سازی
×  ×  ü ü ×  ×  ×  خنثی سازی
× × × در مقادیر کم × × ü دفن بهداشتی
در مقادیر کم ×  ×  در مقادیر کم × 

× 

 

×  تخلیه فاضلاب شهری

 

موضوعات: بدون موضوع  لینک ثابت
 [ 07:43:00 ق.ظ ]




حمل و نقل  پسماند ها در داخل و خارج از سایت درمانی

حمل و نقل پسماند در داخل بیمارستان توسط ظروف چرخ‌دار یا کانتینرهایی که برای هیچ کار دیگری استفاده نمی‌شوند، در محدوده بیمارستان استفاده می شوند. این وسایل باید به آسانی بارگیری و تخلیه شوند و لبه‌های تیز و برنده نداشته باشند تا هنگام بارگیری و تخلیه باعث پاره شدن کیسه‌ها نشده و به آسانی قابل تمیز کردن بوده و روزانه گندزدایی شوند(WHO, 2001).

دانلود پایان نامه

شایان ذکراست در کالیفرنیا،مواد زائد بیمارستانی به سه طریق جمع‌ آوری‌ می‌شوند:

1- استفاده از چرخ‌های دستی: این روش حمل از نوع افقی‌ است. اگر کیسه‌ها پاره شده و یا ظروف سوراخ شوند، احتمال‌ تماس بیماران، کارکنان و یا عیادت‌کنندگان با عوامل عفونی‌ وجود دارد، همچنین استفاده از چرخ‌های اتوماتیک بدون استفاده از پرسنل مناسب ‌تر است.

2-استفاده از شوت‌های پسماند: در این روش  انتقال مواد به صورت ثقلی‌ می باشد و حمل و نقل در مسیر خاصی انجام می‌شود و امکان آلودگی راهروها و سالن‌ها وجود ندارد. از معایب‌ این روش، امکان باز شدن کیسه ‌ها و یا گیر کردن در مسیر و شکسته شدن ظروف است.

3- استفاده از لوله‌های پنوماتیک: این روش برای حمل و نقل‌ مواد زائد پزشکی در مراکز پزشکی بزرگ بسیار مناسب است که از جریان هوا استفاده می‌شود. طول مدت انتقال مواد کوتاه است و این روش در کالیفرنیا کاربرد وسیعی دارد(Cheremisinoff and shah, 1990).

این درحالی است که در ایران طبق بررسی های به عمل آمده تقریبا 57%  از ترولی چرخ دار و 47% از ترولی وبین  استفاده می کنند(عراقی زاده ،1382).

لازم به ذکر است برای حمل و نقل پسماند بیمارستانی در خارج از بیمارستان پسماند‌ها ابتدا در پوشش مناسب قرار می گیرند که قابل سوراخ شدن نبوده و در برابر مواد شیمیایی، ارتعاش و تغییر درجه حرارت و رطوبت یا تغییر فشارمقاوم باشند و براساس مقررات ملی برچسب زده شده و توسط ماشین آلات مناسبی که به همین منظور طراحی شده حمل می شوند. مسیرهای حمل پسماند بیمارستانی باید کوتاه‌ترین و ایمن‌ترین مسیرهای ممکن باشند و درصورت نیاز ایستگاه‌های انتقال مناسب و منطبق با اسلوب مهندسی و بهداشتی برای حمل مواد در مسیر طراحی شوند(وزارت بهداشت، درمان و آموزش پزشکی ,1386 ).

بر اساس بررسی های انجام شده علیرغم تفکیک پسماند ها توسط بیمارستان، حمل آن در یک خودرو و به صورت مخلوط انجام می­گیرد که این روش از نامناسب­ترین روش­ها جهت حمل پسماند به خارج از بیمارستان می­باشد. اصولاً برای حمل و نقل باید ماشین­های خاصی در نظر گرفته شوند و استفاده از ماشین­های روباز برای حمل مخاطرات جدی برای بهداشت عمومی و محیط زیست به ﻫﻤﺮﺍﻩ ﺩﺍﺭﺩ. ﻣﺎشینﻫﺎﻱ ﺯﺑﺎﻟﻪﮐﺶ ﺑﺎﻳﺪ ﻃﻮﺭﻱﻃﺮﺍﺣﻲﺷﻮﻧﺪ ﮐﻪ ﺍﺯ ﻧﺸﺖ شیرابه ﺯﺑﺎﻟﻪ ﻭ ﺭﻳﺨﺘﻦ ﺁﻥ ﺩﺭ ﻣﺴﻴﺮ ﺣﺮﮐﺖ ﺟﻠﻮگیری کنند(وزارت بهداشت، درمان و آموزش پزشکی ,1386 ). لذا یکی از مهمترین مراحل در مدیریت سیستماتیک زائدات مراکز بهداشتی و درمانی، تنظیم اجرای یک برنامه ثابت و مستمر برای برداشت مخازن و جمع آوری زائدات تولیدی در داخل و حمل آن به خارج می باشد .(WHO, 2001)

عکس مرتبط با محیط زیست

18)گاری‌های مخصوص حمل زباله که برای کاردیگراستفاده نمی‌شود.

19)گاری‌های مخصوص مجهزبه طبقات جهت حمل محلفه ولباس بیماران است.

بررسی پسماندهای بیمارستانی (موردمطالعه : بیمارستان شهدای تجریش تهران)

موضوعات: بدون موضوع  لینک ثابت
 [ 07:42:00 ق.ظ ]




نگهداری سوابق مدیریتی پسماند

سوابق مدیریتی پسماند نشان دهنده سندی است  که برای تصمیم گیری آگاهانه  در مدیریت پسماند برای برنامه های آتی می باشد که با الزامات زیست محیطی و سلامت عمومی منطبق است. بر این اساس، سوابق برخی از اطلاعات مهمی است که برای ارزیابی هزینه های مکر، کمیت و کیفیت پسماند های تولید شده، هزینه های مرتبط با انسان، هزینه های مرتبط با درمان ضایعات و روش دفع، خطرات مرتبط با تولید پسماند وارزیابی شکست، مشکل و موانع در مدیریت مواد زائد می­باشند .(Wayne, 1996)

 

1-8-6 آموزش ادواری کارکنان به منظور روزآمد کردن دانش آن ها

آموزش و آگاهی پرسنل در خصوص نحوه مواجهه با زائدات بیمارستانی جهت حفاظت آنها در مقابل تهدیدات احتمالی ناشی از زائدات ضروری می باشد. به همین علت افراد مسئول در بخش مدیریت زائدات بیمارستانی به ویژه مدیر بیمارستان باید آموزش طرح مدیریت پسماند های پزشکی را برای کارکنان مدنظر قرار دهد. آموزش باید شامل موارد ذیل باشد :(Wayne, 1996)

  • توضیح و شرح کاملی از طرح مدیریت پسماند های بیمارستانی
  • واگذاری نقش ها و مسئولیت ها به پرسنل
  • آگاهی درباره خطرات موجود در مدیریت پسماند های بیمارستانی
  • استفاده مناسب از تجهیزات حفاظتی شخصی
  • اجرای سیستم مدیریت مواد زائد (شناسایی پسماند، تفکیک، برچسب زدن، حمل و نقل، درمان و دفع)
  • آیین نامه ها و عواقب ناشی از عدم به پیروی

آموزش باید به دنبال توسعه و اجرای طرح مدیریت انجام شده و زمانی که کارکنان جدید استخدام می­شوند، درصورت  تغییر شیوه ­های مدیریت ، دوره­ای برای آگاهی  برگزار شود. لذا با بهره گرفتن از افراد آموزش دیده و متخصص در زمینه ­های مختلف  می­توان در بالا بردن کیفیت خدمات و بهره ­برداری صحیح از بیمارستان گام های موثری برداشت. در حال حاضر عفونت­های بیمارستانی یکی از دلایل عمده مرگ و میر بیماران بستری می­باشد که به طور مستقیم و غیر مستقیم سبب افزایش چشمگیر هزینه­ های بیمارستانی و ایجاد مخاطرات بهداشتی می­گردد (Wayne, 1996).

شایان ذکر است که افراد مسئول جمع آوری پسماند باید پوششی مطابق (شکل1-5 ) داشته باشند که یکی از راه­های پیشگیری حوادث و بیماری های شغلی استفاده کارگران از وسایل حفاظت فردی مثل لباس کار، پیش بند، کلاه ایمنی، عینک حفاظتی، گوش حفاظتی، دستکش­های حفاظتی، ماسک­های حفاظتی، کفش حفاظتی می­باشد که می­بایست با توجه به شغل کارگر و نیاز او به یک یا چند نوع وسیله حفاظتی انفرادی از طرف کارفرما تهیه و در اختیارشان قرار داده شود .(WHO, 1999)

1 (Personal Protective Equipment (PPE)

موضوعات: بدون موضوع  لینک ثابت
 [ 07:40:00 ق.ظ ]




برنامه­ ریزی مدیریتی و بهینه­ سازی سیستم­های جمع­ آوری و دفع پسماند در مراکز درمانی

بسیاری از کشور ها در حال حاضر مدیریت پایدار پسماند را به عنوان یک اولویت در دستور کار خود قرار داده اند . مدیریت پایدار پسماند خود بر پایه اصول پیشرفت پایدار است. این اصول برای مدیریت پسماند به نحوی است که هیچ گونه خطری برای سلامت انسان و محیط زیست نداشته باشد و هیچ بار سنگینی را بر دوش آیندگان نگذاشته باشد و هیچ مواد غیر قابل تجدید پذیری تولید نگردد. .یک روش متداول برای رسیدن به سیستم مدیریت پایدار پسماند از طریق سلسله مراتب مدیریت پسماند به شکل هرم ذیل می باشد. در ابتدا اولویت اول کاهش تولید پسماند با بیشترین سطح پوششی نمودار، قرار دارد و پیشگیری از تولید پسماند در سطح جهان به شدت مورد توجه و اهمیت می باشد(Ministry of Environment and Energy, 2001)0

عکس مرتبط با محیط زیست

در این هرم اولین گام برای کاهش اثرات زیست محیطی پسماند پیشگیری از تولید پسماند است. این هرم نشان می دهد که بهترین راه حل برای کاهش مخاطرات زیست محیطی پسماند جلوگیری از تولید پسماند است. با این حال جلوگیری از تولید پسماند همیشه امکان پذیر نیست و دیگر راه حل ها می بایست در نظر گرفته شود.این امر فقط با اصلاح الگوی مصرف مواد و تجهیزات و وسایل مورد نیز در بیمارستان میسر خواهد شد.بعد از کاهش تولید پسماندها، به ترتیب  باید به جداسازی و تفکیک و استفاده مجدد از پسماندها، بازیافت و انجام پیش تصفیه به منظور بی‌ خطر سازی و در نهایت دفع پسماند باقی‌ مانده پرداخت((Alyin and Kocasoy,2008.

لذا شرط تضمین موفقیت این برنامه، مراحل حمایت و مشارکت مدیران بیمارستان‌ها در برنامه مدیریت پسماند است و بدون خواست و حمایت آنها اجرای مراحل ذکر شده به موفقیت لازم نخواهد رسید.به کارگیری این گونه برنامه‌ ها از نظر حجمی حداقل بیش از ۲۰% از مقدار پسماند تولیدی و به تناسب هزینه‌های مدیریت پسماندها نیز کاسته شده و مجموعه این هزینه‌ها  در طول یک سال به صدها هزار دلار خواهد رسید.Dahamavarnm et al,1990))

مدیریت صحیح پسماندهای بیمارستانی از لحاظ زیست محیطی دارای اهمیت فراوان می باشد و چنانچه مدیریت پسماندهای بیمارستانی به درستی صورت نگیرد، علاوه بر تأثیرات سوء بهداشتی، بر فعالیت های اصلی بیمارستان تأثیر گذارخواهد بود و برای محیط زیست نیز اثرات سوء در بر خواهد داشت. رهنمودهای مدیریت مواد زائد بیمارستانی نه تنها در به حداقل رساندن خطرات مطرح برای کارمندان در تمامی سطوح کمک می کنند، بلکه خطرات بالقوه محیط زیست را نیز کاهش می دهد .(Burd,2005) ‌

به طور کلی مدیریت پسماندهای بیمارستانی شامل به حداقل رساندن زائدات و بازیافت، ضدعفونی با بهره گرفتن از بخار، امواج کوتاه، حرارت، اشعه گاما، ضدعفونی با بهره گرفتن از مواد شیمیایی، سوزاندن، خنثی سازی، دفن بهداشتی و دفع در شبکه فاضلاب شهری می باشند(Abedi  and Vaezzade, 2002)).

یکی از ارکان مهم در امر مدیریت پسماند های بیمارستانی ایجاد پیوستگی و ارتباط مناسب بین عناصر موثر تشکیل دهنده ی سیستم در مراکز درمانی می باشد. آموزش ادواری کارکنان به منظور روزآمد کردن دانش آن­ها ، جمع آوری و دفع زائدات، بهبود فرایند ها ،جایگزینی وسایل و مواد،آماده کردن تجهیزات فنی و ایمنی برای کارگران بخش خدمات و بخش اعظم پیوستگی و ارتباط درونی بیمارستانی را تشکیل می دهد. سیستم خدماتی بهداشتی و درمانی برای تامین حفظ و ارتقا سلامت و اعاده­ی آن هنگام بیماری افراد جامعه سازماندهی شده است. بیمارستان­ها که بخش اعظم سیستم درمانی را تشکیل می­ دهند، لازم است الگوی نظافت و سمبل پاکیزگی و بهداشت باشند. به منظور تامین هدف­های اساسی و بنیادی بیمارستان و ایجاد محیطی سالم و ارتقا بهداشت بیمارستان الزامی است. بالابردن سطح بهداشت بیمارستان از جنبه­ های انسانی ، اقتصادی و بهداشتی حائز اهمیت است(Prakriti, 2007) .

عکس مرتبط با اقتصاد

درﺣﺎلﺣﺎﺿﺮ ﭘﺴﻤﺎﻧﺪﻫﺎیﺑﯿﻤﺎرﺳﺘﺎﻧﯽ ﺑﻪ دو روش اﺻﻠﯽ ﻣﺪﯾﺮﯾﺖ ﻣﯽﺷﻮد:

1 – اﺳﺘﻔﺎده ازﺳﯿﺴﺘﻢﻫﺎیﺿﺪﻋﻔﻮﻧﯽﮐﻪ ﻋﻤﺪﺗﺎ از اﺗﻮﮐﻼو اﺳﺘﻔﺎده ﻣﯽﺷﻮد.

2 – اﺳﺘﻔﺎده از زﺑﺎﻟﻪ ﺳﻮز

اﻟﺒﺘﻪروشﻫﺎی دﯾﮕﺮﻫﻤﭽﻮن ﭘﺎﮐﺴﺎزی ﺷﯿﻤﯿﺎﺋﯽ،ﻣﯿﮑﺮووﯾﻮ و غیره ﻧﯿﺰ ﮐﺎرﺑﺮدﻫﺎﯾﯽ در ﺑﺮﺧﯽ ﮐﺸﻮرﻫﺎ دارد اﻣﺎ روشﻫﺎی اﺻﻠﯽ ﻫﻤﺎن اﺗﻮﮐﻼو و زﺑﺎﻟﻪﺳﻮز ﻣﯽﺑﺎﺷﺪ. درﮐﺸﻮرﻫﺎی اروﭘﺎﯾﯽ روش اﺻﻠﯽ اﻣﺤﺎی ﭘﺴﻤﺎﻧﺪﻫﺎی ﺑﯿﻤﺎرﺳﺘﺎﻧﯽ، اﺳﺘﻔﺎده زﺑﺎﻟﻪﺳﻮز ﻣﺮﮐﺰی اﺳﺖ. ﺑﺮای ﻣﺜﺎل درﮐﺸﻮر ﺳﻮﺋﯿﺲ، ﺑﻪﮔﺰارش ﺳﺎزﻣﺎن ﻣﺤﯿﻂزﯾﺴﺖ اﯾﻦ ﮐﺸﻮر، ﻫﻤﻪ ﭘﺴﻤﺎﻧﺪﻫﺎی ﻗﺎﺑﻞ ﺳﻮزاﻧﺪن ﮐﻪ ﺑﺎزﯾﺎﻓﺖ ﻧﻤﯽﺷﻮﻧﺪ ﺑﺎﯾﺪ در ﯾﮑﯽ از 28 زﺑﺎﻟﻪﺳﻮز ﺷﻬﺮی اﯾﻦ ﮐﺸﻮر ﺳﻮزاﻧﺪه ﺷﻮﻧﺪ. در ﻧﺮوژ ﭘﺴﻤﺎﻧﺪﻫﺎی ﺑﯿﻤﺎرﺳﺘﺎﻧﯽ ﺳﻮزاﻧﺪه ﺷﺪه و ﻫﻤﺎﻧﻨﺪ ﮐﺸﻮرﺳﻮﺋﯿﺲ ازآن اﻧﺮژی ﺑﺮق ﮔﺮﻓﺘﻪ ﻣﯽﺷﻮد و آﻣﺎر ﻣﻮﺟﻮد ﻧﺸﺎﻧﮕﺮ اﻓﺰاﯾﺶ ﺳﺎﻻﻧﻪ اﯾﻦ ﺗﻮﻟﯿﺪ اﻧﺮژی اﺳﺖ. .(Akter, 2000.)

 

موضوعات: بدون موضوع  لینک ثابت
 [ 07:39:00 ق.ظ ]




نقش مدیران بیمارستان  در مدیریت پسماندهای  بیمارستانی

همه مردم و مدیران مراکز بهداشتی ودرمانی به ویژه بیمارستان ها، خود را طبق اصل 50 قانون اساسی حافظ منافع ملی و محیط زیست و دوستدار محیط زیست می دانند. لذا همکاری مدیران قسمت های مختلف بیمارستانی شامل رئیس، مدیریت، مدیر پسماند بیمارستان، مترون و مسئولین بخش ها، کمیته کنترل عفونت های بیمارستانی، مدیر پشتیبانی وتاسیسات، کمیته پسماند و مسئول بهداشت بیمارستان مورد نیاز است و حمایت مدیران و نظارت مشوقانه و انجام به موقع وظایف آن ها، نقش تعیین کننده ای در موفقیت مدیریت پسماندهای بیمارستانی ایفاء می کند(محمدی بقائی و قلی زاده، 1379).

عکس مرتبط با محیط زیست

از مهمترین وظایف مدیران تشکیل تیمی است که بتواند خط مشی و طرح جامع مدیریت پسماند را تعیین کند. بیمارستان ها قادرند با اعمال مدیریت موثر و جداسازی و تفکیک در مبداء زائدات تولیدی، هزینه های بخش تصفیه و دفع را تا حد قابل توجهی کاهش دهند. چرا که با کاهش حجم زائدات تولیدی، وسایل و تجهیزات مورد نیاز تصفیه و دفع نیز کاهش می یابد. در نتیجه سیاست منطقی و معقول و اقتصادی درهر سازمانی این است که یک کمیته مدیریت مواد زائد مخصوصاً در بیمارستان های بزرگ آموزشی که خدمات مراقبتی زیادی را ارائه می دهند، وجود داشته باشد. این کمیته باید به وسیله رئیس بیمارستان  اداره شود و مسئول مدیریت پسماند بیمارستان باید عضو این کمیته باشد. سایر اعضاء مسئول کمیته کنترل عفونت بیمارستان، شامل بعضی مسئولین بخش ها، مسئول اطاق های عمل، رئیس پرستاری، مسئول امور بهداشتی، مسئول بخش مهندسی و تعمیر و نگهداری ومسئول ایمنی می باشند(Michael et al, 2004 ).

عملکرد کمیته پسماند به شرح زیر می باشد:

  • اطمینان از کیفیت بالای مدیریت پسماند در بیمارستان.
  • اصلاح و بهینه کردن برنامه ها و سیاست مدیریت پسماند بیمارستانی و تصویب آن.
  • تعیین وظایف مسؤلین مختلف در زمینه مدیریت پسماند بیمارستان.
  • ارزیابی و پایش مدیریت موثر پسماند در بیمارستان.
  • اطمینان از مناسب بودن و به موقع بودن برنامه های آموزشی برای همه طبقات کارکنان
  • ایجاد زیرکمیته بازیافت و ارائه برنامه های مخصوص و در ادامه پیگیری دستاوردهای آن )انصاری، 1382).

— رئیس بیمارستان

رئیس بیمارستان، مسئول تنظیم پیگیری و اجرای دستور العمل های مدیریت مواد زائد بیمارستانی، طرح خط مشی ها و ایجاد روش های علمی استاندارد می باشد. او مسئول اصلی در رابطه با خط مشی ها و اقدامات مربوط به مدیریت مواد زائد به کلیه مراکز خارج از بیمارستان بوده و مسئول ارائه گزارش سالیانه درخصوص میزان وحجم و مشخصات پسماند های تولیدی وگزارش حوادث احتمالی خواهد بود. همچنین باید کمیته مدیریت مواد زائد را تشکیل داده و به طور شفاف وظایف و مسئولیت های اعضاء را مشخص و پیگیری کند و در تمام برنامه­ها کاهش تولید پسماندها را مورد توجه جدی قرار دهد. مدیر زائدات بیمارستان نقش مهمی در جهت اجرا و هدایت طرح جامع پسماند دارد و مدیریت پسماند بیمارستان تحت سرپرستی او و مطابق اصول و ضوابط ملی وآخرین رهنمودها و دستورالعمل های جاری و بر اساس اصول ایمنی انجام می شود( بقائی، 1379).

— مسئول مدیریت مواد زائد

مسئول مدیریت مواد زائد باید یک مشاور با تجربه و با سابقه باشد. یک کاردان و یا کارشناس بهداشت محیط که باید مستقیماً وضع موجود و موارد لازم را به مدیر گزارش دهد. او باید در رابطه با مدیریت علمی مواد زائد بیمارستانی مطلع بوده و در مورد نقش خود انگیزه کافی داشته باشد. او مسئول اجرای این برنامه می باشد و باید با کلیه مسئولین بخش ها، مسئول کنترل عفونت، رئیس پرستاری، کارکنان بهداشتی و کارکنان تعمیر و نگهداری در تماس باشد و همچنین مسئول اجرای برنامه­ها بر طبق قوانین و مقررات در زمان ها و در سطوح مختلف مانند تولید، جداسازی، جمع آوری، انبار، پالایش و دفع  باشد. مدیر زائدات بیمارستان باید روزانه بر سیستم و طرح مدیریت زائدات کنترل و نظارت کافی داشته باشد. به همین علت او باید ضرورتاً به تمام پرسنل بیمارستان دسترسی داشته باشد و مطابق اصول و ضوابط ملی وآخرین رهنمودها و دستورالعمل­های جاری، باید در مقابل رئیس بیمارستان پاسخگو باشد. همچنین باید با مشاورین مسئول کنترل عفونت و بخش دارویی و رادیولوژی جهت اصلاح روش های جاری مدیریت پسماند در مراحل حمل و نقل و دفع زائدات پاتولوژیک و دارویی و شیمیایی و پسماند رادیواکتیو، ارتباط نزدیکی داشته باشد(Miyazaki,2005 ).

موضوعات: بدون موضوع  لینک ثابت
 [ 07:37:00 ق.ظ ]




مدیر مسئول کنترل عفونت

مدیر مسئول کنترل عفونت نقش مهمی در کیفیت خدمات و مراقبت های بهداشتی و درمانی بیمارستان دارد و محیط سالمی برای پرسنل شاغل در بیمارستان فراهم می نماید(Diaz ,2005) .

— مسئول بهداشت

مسئول بهداشت، مسئول اجرای روزانه، نظارت وارزیابی مدیریت مواد زائد بیمارستان از تولید، نگهداری، جمع آوری و حمل ونقل تا دفع نهایی آنها خواهد بود. او در جلسات کمیته مدیریت مواد زائد و کمیته کنترل عفونت های بیمارستانی شرکت کرده و باید از آموزش کارکنان تحت امر خود مطمئن شود. آموزش و ارزیابی متداول ضمن خدمت کارکنان امور بهداشتی، توسط او اجرا خواهد شد. همچنین باید تحت هرشرایطی، کمک و همکاری لازم را با مسئول مدیریت پسماند بیمارستانی داشته باشد((Enkhtsetseg, 2007.

با توجه به نتایج و بحث های به عمل آمده مشخص شده است که یکی از مشکلات مدیریت پسماندهای بیمارستانی، عدم وجود تشکیلات مدون در مجموعه بیمارستان می باشد، لذا با توجه به تشکیلات مدیریتی  که در شکل ذیل آمده است پیشنهاد می گردد که تدابیر مدیریتی  برای  افزایش آگاهی پرسنل مرتبط و درگیر در بیمارستان اتخاذ گردد تا در آینده بیمارستان ها منطبق با استانداردهای جهانی شوند .(WHO, 1999)

11جنبه های  اقتصادی در مدیریت پسماند های بیمارستانی

عکس مرتبط با اقتصاد

برای مهار هزینه ها، کارکنان مرکز باید به طور خاص جدا سازی پسماند های بیمارستانی را آموزش ببینند. لذا تفکیک باید در منبع انجام شود تا ازدردسرهای پسماند­های بیمارستانی محافظت شوند. جداسازی صحیح مواد زائد مختلف منجر به تصفیه و دفع مناسب آنها می­ شود و جداسازی نامناسب یا غیر اصولی باعث ایجاد خطراتی برای پرسنل، جامعه و افزایش هزینه­ها می­ شود که روشی غیر اقتصادی خواهدبود. متاسفانه این مرحله از جداسازی که مسئولیت آن بر عهده تولید کننده مواد زائد است، اکثراً به بخش بهداشتی پایین­تر محول می­ شود. با توجه به این که اکثر پزشکان به میزان زیادی تحت شرایط اضطراری و فشار می­باشند و آگاهی کمی نسبت به مقدار، حجم و نوع مواد زائد تولید شده وشیوه دفع آنها دارند، این اشخاص به ندرت درباره عواقب مدیریت غیر اصولی مواد زائد و خطرات ناشی از آن فکر می­نمایند. از آن جایی که هزینه تصفیه و دفع مواد زائد خطرناک وعفونی عمومأ بیش از 10 برابر مواد زائد معمولی است، تأکید بر مسأله تفکیک در مبدأ و تأثیر آن در کاهش هزینه­ های بیمارستان حائز اهمیت می باشد(موسوی ،1384).

موضوعات: بدون موضوع  لینک ثابت
 [ 07:36:00 ق.ظ ]




تاریخچه بیمارستان شهدای تجریش

این مرکز در گذشته­ای، حدود 90 سال قبل آرامگاه بوده و پس از آن به تملک شهرداری درآمده و بعنوان بلدیه (شهرداری) شناخته شد( به مدت حدوداً 20 سال). سپس به عنوان درمانگاه و مرکز واکسیناسیون که ساختمان آن در محل غذاخوری فعلی بوده فعالیت داشته است. پس از واگذاری املاک مرکز به سازمان شاهنشاهی و خدمات اجتماعی آن زمان، فعالیت رسمی بیمارستان با احداث ساختمان 3 طبقه موجود در سال 1340 آغاز گردید. به دنبال آن به ترتیب ساختمان های فعلی درمانگاه ها و پاویون پزشکان در سال 1347 و ساختمان 6 طبقه (ساختمان اصلی بخش ها) در سال 1348 با نام رضا پهلوی افتتاح شده است. در سال های 1350 و 1351 سازمان مزبور به منظور اجرای طرح گسترش بیمارستان، اقدام به خرید ساختمان های مسکونی جنب خیابان های دربند و حمید نموده است، اما به دلیل عدم ادامه طرح فوق در حال حاضر این زمین ها به صورت، پارکینگ، انبارها، بخش فیزیوتراپی و ساختمان های نقلیه و اداری و مالی استفاده می گردد. کلیه املاک و ساختمان ها نیز پس از انقلاب اسلامی جزء املاک دولتی شناخته شده و در تملک بیمارستان قرار گرفته است.

دانلود پایان نامه

3-1-2  چارت سازمانی بیمارستان شهدای تجریش

این مرکز در حال حاضر 297 تخت دایر دارد. تخصص­های موجود در این بیمارستان عبارتند از : داخلی ٬ جراحی ٬ کودکان، زنان و زایمان، جراحی مغز و اعصاب٬ ارولوژی٬ نرولوژی٬ هماتولوژی ٬ سرطان ٬ غدد ٬ CCU , ICU . لازم به ذکر است که 22 تخت ICU، یک دستگاه MRI، سیستم حرارت خورشیدی، دستگاه اکسیژن‌سازی جدید طراحی ‌شده است.

خدمات بیمارستان شهدای تجریش

خدمات اورژانس و فوریت های پزشکی:

بخش اورژانس این مرکز، یکی از مراکز بزرگ پذیرش تروما و فوریت های پزشکی تهران بوده و دارای اورژانس های جراحی عمومی و عروق، جراحی اعصاب، داخلی و فوق تخصص های مربوط، نورولوژی، کودکان، ارولوژی و زنان و مامایی می باشد.

 

خدمات بستری:

در بخش بستری این مرکز خدماتی شامل جراحی مغز و اعصاب، جراحی عمومی، عروق و تروما، جراحی ارولوژی(اندریولوژی، سیستو سکپی، سنگ شکنی درون اندامی و پیوند کلیه)، جراحی زنان و زایمان، بیماری های داخلی(گوارش، نفرولوژی، غدد، ریه، روماتولوژی و قلب)، بیماری های پوست، نورولوژی(داخلی- اعصاب) بیماری های کودکان(هماتولوژی و انکولوژی اطفال، نوزادان و NICU)شیمی درمانی و پرتو درمانی بزرگسالان ،دیالیز ، CCU و ICU ارائه می‌گردد.

 

موضوعات: بدون موضوع  لینک ثابت
 [ 07:34:00 ق.ظ ]




خدمات بیمارستان شهدای تجریش

خدمات اورژانس و فوریت های پزشکی:

بخش اورژانس این مرکز، یکی از مراکز بزرگ پذیرش تروما و فوریت های پزشکی تهران بوده و دارای اورژانس های جراحی عمومی و عروق، جراحی اعصاب، داخلی و فوق تخصص های مربوط، نورولوژی، کودکان، ارولوژی و زنان و مامایی می باشد.

دانلود پایان نامه

 

خدمات بستری:

در بخش بستری این مرکز خدماتی شامل جراحی مغز و اعصاب، جراحی عمومی، عروق و تروما، جراحی ارولوژی(اندریولوژی، سیستو سکپی، سنگ شکنی درون اندامی و پیوند کلیه)، جراحی زنان و زایمان، بیماری های داخلی(گوارش، نفرولوژی، غدد، ریه، روماتولوژی و قلب)، بیماری های پوست، نورولوژی(داخلی- اعصاب) بیماری های کودکان(هماتولوژی و انکولوژی اطفال، نوزادان و NICU)شیمی درمانی و پرتو درمانی بزرگسالان ،دیالیز ، CCU و ICU ارائه می‌گردد.

 

خدمات تشخیصی و پاراکلینیکی:

در واحدهای مختلف این مرکز خدماتی به شرح ذیل صورت می پذیرد :

  • آزمایشگاه تشخیص طبی: شامل آزمایشات هورمون شناسی، قارچ شناسی، میکروب شناسی، بیوشیمی، انگل شناسی، سرولوژی، بانک خون و هماتولوژی.
  • تصویربرداری پزشکی: رادیولوژی ساده و تهاجمی(بیوبسی تحت گاید سی تی اسکن و سونوگرافی)، سی تی اسکن، آنژیوگرافی DSA(عروق محیطی، مداخله ای واسکولار یا اینترونشنال و نیز تشخیصی قلبی)، نورورادیولوژی، سونوگرافی، داپلر رنگی، ماموگرافی وMRI.
  • رادیوتراپی و رادیو ایزوتوپ: درمان سرطانهای توده جامد(رادیوتراپی با کبالت، رادیوتراپی با شتاب دهنده خطی، رادیوتراپی درون حفره ای)، پزشکی هسته ای(ید تراپی و خدمات تشخیصی با SPECT از قبیل اسکن استخوان، کبد، قلب، تیروئید و کلیه).
  • طب فیزیکی و توانبخشی : NCV/EMG، گفتار درمانی، کاردرمانی، فیزیوتراپی و …
  • آسیب شناسی پزشکی : بررسی میکوسکوپی انواع بیوپسی ها و نمونه های سرطانی
  • خدمات پاراکلینیک مغز و اعصاب : استریوتاکسی و آندوسکوپی مغزی، نوار نگاری مغزی
  • خدمات پاراکلینیک داخلی : آندوسکوپی گوارشی ، نفروسکپی، رکتوسکپی ، اسپیرومتری ، برونکوسکوپی، ERCP
  • خدمات پاراکلینیک قلب: اکوکاردیوگرافی، تست ورزش و نوارنگاری قلبی،
  • خدمات پاراکلینیک چشم پزشکی : بینایی سنجی.
  • فتو تراپی و لیزر : فتو تراپی پوست، لیزر پروستات و پوست، PDT ، NBUVB ، حمام های PUVA.
موضوعات: بدون موضوع  لینک ثابت
 [ 07:33:00 ق.ظ ]




سند

از دوران قدیم تاکنون، سند در ثبت وقایع و اعمال حقوقی نقش مهمی داشته است و در دین مبین اسلام نیز به تنظیم سند برای ثبت تعهدات دستور داده شده است.

مبحث اول- معنای لغوی

سند در لغت به معنای «آنچه بدان اعتماد کنند، مدرک، مستند، و نوشته ای که قابل استناد باشد»، می‌باشد.

و نیز به معنای نوشته ای که وام یا طلب کسی را معین و یا مطلبی را ثابت کند، آمده است.

بنابراین از این دیدگاه سند یک مفهوم عام می‌باشد که عبارت از هر تکیه‌گاه و راهنمای مورد اعتماد است که بتواند اعتماد دیگران را به درستی یک ادعا جلب نماید. مانند نوشته یا گفته یا اقرار چنان که گفته می‌شود فلان خبر یا حدیث دارای سند معتبر است و مقصود این است که شخصیت‌های معتبر و مورد اعتمادی آن‌را نقل کرده‌اند.

دانلود پایان نامه

مبحث دوم- معنای اصطلاحی سند در حقوق

در اصطلاح حقوقی که در قانون مدنی ایران در ماده ۱۲۸۴ آمده است سند چنین تعریف شده است: «سند عبارت است از هر نوشته که در مقام دعوی یا دفاع قابل استناد باشد». طبق این تعریف سند باید نوشته باشد، و نوشته نیز به هر علامت و یا خطی گفته می‌شود که بر روی چیزی نمایان شده باشد. این نوشته ممکن است به صورت رمز و یا بر روی کاغذ، سنگ، صفحه‌ی فلزی و یا هر چیز دیگری باشد که قابلیت پذیرفتن نقش را داشته باشد.

 

 

فرهنگ حقوقی انگلیسی، سند را چنین تعریف می‌کند: «سند وسیله‌ای است که روی آن حرف، شکل، علامت، صورت اصلی یا رسمی یا قانونی چیزی ثبت شده باشد و در مقام دلیل بکار می‌آید. در این معنی اصطلاح سند، نوشته، حروف چاپ شده، چاپ سنگی، عکس، طرح و نقشه و حتی قطعه سنگی را شامل می‌شود که روی عبارتی حک کرده باشند. سند در معنی جمع (یعنی اسناد) به معنی قرارداد و طرح و نامه و هر مدرک نوشته‌ای را شامل می‌شود که برای اثبات واقعه‌ای بکار می‌رود. سند که بهترین دلیل اثبات دعوی است، تجسم مادی خبر یا فکر است، مانند نامه، قرارداد، رسید، دفتر حساب، مسدوده، عکس اعم از طبی و غیر طبی، و پلاک یا صفحه».

در حقوق فرانسه، سند نیز به معنی ماده ۱۲۸۴ قانون مدنی ایران بکار رفته است، و مطابق تعریف فرهنگ حقوقی دالز، سند برای تثبیت یک واقعه حقوقی، یا واقعه‌ای ساده بکار می‌رود.

- «یَا أَیُّهَا الَّذِینَ آمَنُواْ إِذَا تَدَایَنتُم بِدَیْنٍ إِلَى أَجَلٍ مُّسَمًّى فَاکْتُبُوهُ وَلْیَکْتُب بَّیْنَکُمْ کَاتِبٌ بِالْعَدْلِ… فَلْیَکْتُبْ وَلْیُمْلِلِ الَّذِی عَلَیْهِ الْحَقُّ»

ای کسانی که ایمان آورده‌اید، هرگاه به دینی تا سررسیدی معین، با یکدیگر معامله کردید، آن را بنویسید؛ و باید نویسنده‌ای (صورت معامله را) بر اساس عدالت، میان شما بنویسد…و کسی که بدهکار است باید املاء کند و او (نویسنده) بنویسد.. (سوره بقره، آیه ۲۸۲)

- معین، محمد، فرهنگ فارسی، انتشارات امیر کبیر، تهران، چاپ چهارم ۱۳۶۰، جلد دوم، ص ۱۹۲۹.

- عمید، فرهنگ فارسی، انتشارات دادگستر، تهران، چاپ اول، ۱۳۶۹.

- کاتوزیان، ناصر، اثبات و دلیل اثبات، نشر میزان، تهران، چاپ ششم، ۱۳۸۴، جلد اول، ص۲۷۵.

Blacks Low Dictionary -[5]

- Document

X Ray-[7]

Acte -[8]

Dalloz -[9]

- تعریفی که فرهنگ حقوقی فرانسه از سند می‌آورد به جامعی تعریف فرهنگ حقوقی انگلیسی نیست، ولی عملاً در فرانسه سند شامل تمام انواع نوشته می‌شود بدون آنکه نظری به ذات یا موضوعی باشد که این نوشته بر روی آن نقش بسته است.

حسینی نژاد، حسینقلی، ادله‌ی اثبات دعوی، نشر میزان، تهران، چاپ اول، ۱۳۷۴، ص ۶۳ و ۶۴.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:32:00 ق.ظ ]




- ارکان سند

طبق تعریف ماده ۱۲۸۴ ق.م، که در تعریف سند به معنی خاص می‌گوید: «سند عبارت است از هر نوشته که در مقام دعوی یا دفاع قابل استناد باشد»، دلیلی سند محسوب خواهد شد که دارای دو رکن و شرط اساسی باشد:

گفتار اول- رکن شکلی

منظور از سند در حقوق، نوشته است وگرنه تمام ادله‌ی اثبات دعوی سند تلقی می‌شدند. پس با این قید، تمام ادله‌ای که به صورت مکتوب در نیامده است از تعریف سند خارج می‌شود.

دانلود پایان نامه

آوردن قید کتبی بودن در تعریف سند کاملاً ضروری است، برخلاف برخی که بر این عقیده هستند که چون کتبی بودن سند صفت ذاتی و لاینفک سند است و آوردن صفت کتبی بودن برای سند قیدی زائد است. چرا که اولاً برای تعریف لفظ سند از لحاظ منطقی، لازم است که جنس آن مشخص باشد و جنس سند نیز نوشته شود. ثانیاً لفظ سند به معنای عام گاهی اوقات شامل دلایل گفتاری و غیر نوشته، مثل اقرار لفظی و امارات نیز می‌شود. به عنوان مثال، هنگامی که گفته می‌شود فلان حدیث دارای سند معتبری است مقصود این است که سلسله راویان عادل و معتمدی این حدیث را از معصوم علیه‌السلام نقل کرده‌اند. یا درجایی که گفته می‌شود سند شما بر صحت ادعایتان چه می‌باشد مقصود این است که قراین و اماراتی برای شما بر صحت ادعاء موجود است.

بند ۲ ماده ۱۲۵۸ ق.م که اسناد کتبی را در زمره دلایل اثبات دعوی آورده است، اشاره به معنی خاص سند دارد که با قید کتبی از مفهوم عام سند یا دلیل جدا می‌شود. پس، نباید قید کتبی را در این ترکیب حشو و قبیح پنداشت؛ و به همین مناسبت در قوانین جدیدتر هم قید کتبی برای سند تکرار شده است. بنابراین اولین رکن سند مکتوب بودن آن است که در قانون هم ذکر شده است.

شهادت‌نامه

اصولاً نوشته‌ای در محاکم مورد استناد طرفین دعوی قرار می‌گیرد که دلیلیت داشته باشد، و آن نوشته، سند می‌باشد؛ مگر اینکه قانونگذار در این مورد استثنایی قائل شده باشد.

تنها فرضی که قانون مدنی، به منظور اخراج نوشته‌ای از زمره اسناد، تصریح کرده، تنظیم شهادت‌نامه است که شخص یا گروهی اطلاعات و مشاهدات خود را، درباره‌ی عمل یا واقعه‌ای که در آن دخالت نداشته‌اند، در نوشته‌ای می‌آورند.

ماده ۱۲۸۵ قانون مدنی ایران از شهادت‌نامه نام می‌برد و می‌گوید شهادت‌نامه سند محسوب نمی‌شود و فقط اعتبار شهادت را خواهد داشت. قانون مدنی شهادت‌نامه را تعریف نکرده است و این اصطلاح هم در کتب فقهی، با آنکه مضمون آن از مصداق، اقرار و شهادت، و شهادت بر شهادت خارج نیست، ولی با معنی و شکل خاص آن وجود ندارد. مطابق تعریف قانون مدنی ایران شهادت‌نامه هم ممکن است شهادت کتبی شاهدی باشد که واقعه‌ای را دیده یا شنیده، و چون خود این شاهد در دسترس نیست شهادت‌نامه‌ی او را در محکمه ارائه می‌دهند، و هم ممکن است معنایی وسیعتر داشته باشد، یعنی به همان معنایی بکار می‌رود که در حقوق خارج رایج است، و آن این است که، کسی که در مسئله‌ی علمی یا اجتماعی بصیرت و اطلاعی جامع دارد، و اطلاع او در محکمه بکار می‌آید و می‌تواند راهنمای محکمه یا اصحاب دعوی باشد، یا اصولاً برای آنکه حقیقت را در یک امر علمی یا اجتماعی به محکمه ابراز کند آنچه درباره‌ی آن مسئله می‌داند در نامه‌ای می‌نویسد و پس از امضای ذیل آن، امضای خود را به تصدیق دفتر اسناد رسمی یا مقام صالح دیگر می‌رساند، و آن نامه را به محکمه می‌فرستد یا به یکی از اصحاب دعوی می‌دهد. قانون مدنی ایران که می‌گوید این شهادت‌نامه سند نیست، اگر صرفاً این شهادت‌نامه حاکی از امر خصوصی باشد، مثلاً نویسنده‌ی شهادت‌نامه بر حقانیت یکی از اصحاب دعوی، یا بر بی‌گناهی متهمی گواهی دهد، این شهادت‌نامه به اندازه یک گواهی معتبر است، ولی اگر نویسنده‌ی شهادت‌نامه دانشمندی باشد که تحقیقات او در مسائل علمی یا اجتماعی حجت باشد، شهادت‌نامه ممضی به امضای او را می‌توان سند پنداشت. ولی چون اغلب شهادت‌نامه‌ها مربوط به واقعه‌ای است فردی، یا اگر هم مربوط به واقعه‌ای جمعی باشد، نویسنده‌ی شهادت‌نامه فقط مشهودات عادی خود را می‌نویسد، قانون ایران هم بدین معنی توجه داشته است که شهادت‌نامه را فقط از نظر اعتبار مانند شهادت فرض کرده است.

 تصویر درباره جامعه شناسی و علوم اجتماعی

- کریمی، عباس، ادله‌ی اثبات دعوی، نشر میزان، تهران، چاپ دوم ۱۳۸۸، ص ۱۲۶.

- واژه‌ی سند به دو معنی عام و خاص بکار رفته است:

به معنی عام، سند عبارت از هر تکیه گاه و راهنمای مورد اعتماد است که بتواند اعتقاد دیگران را به درستی ادعاء جلب کند، خواه نوشته باشد یا گفته و اماره و اقرار؛ چنان که گفته می‌شود فلان خبر یا حدیث دارای سند معتبر است و مقصود این است که شخصیت‌های معتبر و مورد اعتمادی آن را نقل کرده‌اند. همچنین است وقتی که گفته می‌شود فلان سند تاریخی درباره رویدادی ارائه شد، یا ادعای خواهان مستند به دلیلی نیست … و مانند اینها؛

به معنی خاص، نوشته‌ای است که، در مقام اثبات دعوی یا دفاع از آن، می‌تواند راه وصول یا واقعیت باشد. در این معنی دیگر سند مرادف با دلیل و مدرک نیست؛ چهره خاصی از آن مفهوم عام است که به صورت نوشته در آمده و مکتوب است نه منقول. (کاتوزیان، ناصر، همان، ص ۲۷۵).

- کاتوزیان، ناصر، همان، ص ۲۷۵. این در جواب بعضی از حقوقدانان است ذکر آن را حشو می‌دانند: «…وصف سند به کتبی در ماده ۱۲۵۸ که سابقاً ذکر شد حشو قبیح است و صفت کتبی یا غیر کتبی راجع به دلیل می‌تواند باشد نه سند».

شایگان، سید علی، حقوق مدنی ایران، نشر میزان، چاپ دوم، ۱۳۷۹، جلد اول، ش ۲۲۳.

- کاتوزیان، ناصر، همان، ص ۲۷۷.

- شهادت‌نامه ترجمه لغت Affidavit است که به عربی آن را شهادت یا اقرار کتبی به قسم می‌گویند، یعنی گواهی یا اقرار کتبی با قید سوگند. فرهنگ حقوقی انگلیسی شهادت‌نامه را چنین تعریف می‌کند: شهادت‌نامه بیان یا شرح کتبی واقعه‌ای است که با سوگند یا تصدیق آزادانه کسی که این واقعه را شرح می‌دهد همراه است و این سوگند یا تصدیق در مقابل مقامی ابراز شده است که قانوناً حق دارد کسی را سوگند دهد یا تصدیقی از او بخواهد. در حقوق فرانسه شهادتی وجود دارد که معادل همین  Affidavitاست که آن را شهادت کتبی با سوگند می‌نامند، و این شهادت را به ثبت هم می‌رسانند.

- حسینی نژاد، حسینقلی، همان، ص ۶۴.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:30:00 ق.ظ ]




رکن ماهوی

در اصطلاح حقوقی برای آنکه به نوشته‌ای سند گفته شود، آن نوشته باید قابلیت آن را داشته باشد که در دادرسی بتواند دلیل قرار بگیرد. چه آن که دعوایی مطرح نشده باشد یا آنکه تنظیم‌کنندگان، احتمال به وجود آمدن دعوایی را ندهند، مانند قباله نکاح.

پس نوشته‌ای سند محسوب می‌شود که قابلیت استناد را داشته باشد. به این صورت که نوشته دلیلیت داشته باشد، و حاوی دلیلی موضوعی باشد. پس هدف از تنظیم سند، فراهم نمودن امکان استناد به آن است و به همین دلیل، ماده ۱۲۸۴ ق.م قابلیت استناد را در تعریف سند آورده است.

قابلیت استناد، در دو فرض نسبت به نوشته‌های ارائه شده به دادگاه مطرح می‌شود:

۱- فرضی که نوشته به حکم قانون توان اثبات موضوع دعوی را ندارد:

مانند اینکه مدعی در برابر خوانده به قولنامه‌ی عادی فروش ملک او به خود استناد کند و بر پایه آن اجرت‌المثل زمان تصرف خوانده را مطالبه نماید، چرا که قولنامه‌ی عادی برای اثبات مالکیت عین و منافع ملک مورد تعهد قابل استناد نیست و مطلوب خواهان را ثابت نمی‌کند (ماده ۲۲ ق.ث). همچنین است ارائه‌ نوشته‌ی عادی برای اثبات انتقال حق کسب و پیشه و تجارت و ارائه‌ حواله‌ی عادی به جای برات برای اثبات مسئولیت تضامنی محیل و محال‌علیه یا سند عادی شراکت‌نامه و صلح‌نامه و هبه‌نامه یا استناد به نوشته در برابر سند مالکیت و مانند این‌ها. به این مفهوم، قابلیت استناد وصف نسبی و متناسب با دعوای طرح شده است؛ چنانکه قولنامه عادی برای اثبات التزام مالک به بیع قابلیت استناد را دارد، ولی در دعوای مطالبه اجرت‌المثل در دادگاه پذیرفته نمی‌شود.

۲- پاره‌ای از اعلامهای در سند، نه موضوع اصلی تصرف است و نه با آن ارتباط مستقیم دارد.

اینگونه اعلامها را در عرف سردفتران و سندنویسان «رسم‌القباله» می‌نامند و ویژگی آنها در بی‌اعتنایی به مفاد عبارتی است که یا جنبه تشریفاتی دارد یا سنت و عادت سندنویسان شده است. مانند عبارت «شرط ضمن عقد خارج لازم» برای قالب قراردادی که بر طبق ماده ۱۰ ق.م الزام‌آور است. این عبارت را به سادگی می‌توان از سند حذف کرد، چرا که هیچ تغییری در مفاد آن نمی‌دهد؛ و به همین اعتبار هم قابلیت استناد را ندارد. همچنین است اعلام سلامت مزاج در وقفنامه‌ها و هبه‌نامه‌ها و گاه اعلام صوری قبض و مانند این‌ها.

گفتار سوم- امضاء

اصولاً هر نوشته‌ای که در قراردادها، به عنوان سند بین اشخاص، صورت می‌گیرد دارای امضای طرفین می‌باشد؛ به طوری که نوشته‌های مذکور، اگر فاقد امضای یکی از طرفین باشد، در صورت انکار شخصی که آن نوشته را امضاء نکرده است، نوشته‌ی مذکور فاقد اعتبار می‌باشد.

بنابراین، امضای سند را باید به عنوان شرط سوم بر آن افزود، هر چند که پاره‌ای از نوشته‌ها، نیاز به امضاء ندارد و دلالت عرف بر تصمیم نهایی تنظیم‌کننده جای نشان ویژه‌ی امضاء را می‌گیرد.

نوشته‌ی منتسب به اشخاص در صورتی قابل استناد است که امضاء شده باشد. امضاء نشان تأیید اعلامهای مندرج در سند و پذیرش تعهدهای ناشی از آن است و پیش از آن، نوشته را باید طرحی به حساب آورد که موضوع مطالعه و تدبر است و هنوز تصمیم نهایی درباره‌ی آن گرفته نشده است. سند امضاء نشده ناقص است و مهم‌ترین رکن اعتبار را ندارد، هرچند که ممکن است به عنوان قرینه‌ی تأییدکننده‌ی سایر ادله مستند قرار گیرد. به عنوان مثال، اگر اصالت سند امضاء شده انکار شود و ارائه‌کننده‌ی آن، ضمن استناد به نظر کارشناس و تحقیق از گواهان، نوشته‌ی بی امضایی از منکر را ارائه دهد که اقرار به تعهد خود کرده است، دادگاه نوشته را به عنوان سند اقرار نمی‌پذیرد، ولی می‌تواند آن را قرینه بر اصالت سند امضاء شده بداند. لزوم امضاء سند در تعریف ماده‌ی ۱۲۸۳ ق.م نیامده است. ولی، نه تنها از اصول کلی حقوقی و عرف مسلم، این رکن سند به خوبی استنباط می‌شود، استقرار در شرایط اسناد در قوانین گوناگون نیز ضرورت امضاء را، به عنوان رکن اصلی سند، تأیید می‌کند. از جمله ماده‌ی ۱۲۹۳ و مواد ۱۳۰۱- ۱۳۰۴ ق.م، ماده‌ی ۲۲۳ ق.ت در شرایط برات، ماده‌ی ۳۰۷ ق.ت در بیان ارکان سفته، ماده‌ی ۳۱۱ ق.ت در مورد چک، مواد ۲۷۸ و ۲۷۹ ق.ا.ح در مورد وصیت‌نامه‌ها، مواد ۶۳ و ۶۵ ق.ث بدین عبارت: «امضای ثبت سند پس از قرائت آن به توسط طرفین معامله یا وکلای آنها دلیل رضایت آنها خواهد بود» و مانند این‌ها. این احکام چندان تکرار شده و عرف مسلم چنان استقرار یافته است که هیچ تردیدی در لزوم و اهمیت امضای سند باقی نمی‌گذارد. با وجود این، در بعضی موارد خاص، قانونگذار نوشته‌ی بی امضاء را نیز معتبر شناخته است: ماده ۱۲۹۷ ق.م اعلام می‌کند: «دفاتر تجارتی در مورد دعوای تاجری بر تاجر دیگر، در صورتی که دعوی از محاسبات و مطالبات تجارتی حاصل شده باشد، دلیل محسوب می‌شود. مشروط بر اینکه دفاتر مزبوره مطابق قانون تجارت تنظیم شده باشد» و ماده‌ی ۱۲۹۸ می‌افزاید: «دفتر تاجر در مقابل غیر تاجر سندیت ندارد و فقط ممکن است جزء قرائن و امارات قبول شود، لیکن اگر کسی به دفتر تاجر استناد کرد، نمی‌تواند تفکیک کرده، آنچه را که بر نفع اوست قبول و آنچه به ضرر او است رد کند، مگر آنکه بی‌اعتباری آنچه را که بر ضرر او است ثابت کند».از این حکم خاص نباید درباره‌ی رکن بودن امضاء به تردید افتاد. زیرا، قانونگذار بر پایه‌ی تشریفات و آثار این دفاتر، ثبت واقعه یا طلب و تعهدی را در آن در حکم امضاء دانسته و از داوری عرف هم در این زمینه دور نیفتاده است. وانگهی، سندیت اعتباری دفاتر تجارتی همانند سایر اسناد مطلق و کامل نیست؛ اعتباری ناقص دارد که ویژه‌ی رابطه‌ی بازرگانان است و همین امر حکمی بودن سند را نشان می‌دهد. پس، باید این فرض حقوقی را نیز در زیر مجموعه‌ی اسناد امضاء شده آورد و در قاعده‌ی لزوم امضای سند تردید نکرد.

- تبصره ۲ ماده ۱۹ ق.ر.م.م.

- کاتوزیان، ناصر، همان، ص ۲۷۷ و ۲۷۸.

- در نوشته‌هایی که امضای آن‌ ها از سوی طرفین ضروری می‌باشد.

- کاتوزیان، ناصر، همان، ص ۲۷۶.

- کاتوزیان، ناصر، همان، ص ۲۷۹ و ۲۸۰.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:29:00 ق.ظ ]




ایراد به تعریف قانون مدنی از سند

در اینجا ایراداتی که بعضی حقوقدانان، به تعریف قانون مدنی از سند کرده‌اند می‌پردازیم.

در تعریف ماده ۱۲۸۴ ق.م از سند، قابلیت استناد تنها در مقام دعوی یا دفاع ذکر شده است. این امر باعث می‌شود که گفته شود سند در یک دعوای خاص دلیل محسوب می‌شود و در دعوای دیگری دلیل نیست در حالی که قابلیت استناد سند به این معنا است که سند حاوی دلیل می‌باشد اعم از اینکه در دعوای خاصی به آن استناد بشود یا خیر. به عنوان مثال عقدنامه ازدواج قطعاً سند محسوب می‌شود. چرا که حاوی اقرار به وجود رابطه‌ی زوجیت میان طرفین می‌باشد لکن این سند ممکن است هیچ‌گاه در مقام دعوی مورد استناد قرار نگیرد.

ولی این ایراد وارد نیست، چرا که ظاهراً مقصود قانونگذار این می‌باشد که هر نوشته‌ای که «قابلیت» استناد در دعوای مربوط به آن دعوی را داشته باشد سند محسوب می‌شود و دلیل می‌باشد، و منظور قانونگذار این نیست که اگر نوشته‌ای در مقام دعوی قرار نگیرد سند محسوب نمی‌شود، بلکه از لفظ «قابلیت» همین معنا را می‌توان فهمید که حتی اگر در مقام دعوی هم قرار نگیرد ولی قابلیت استناد در دعوای احتمالی را دارا باشد کافی است.

و نیز به تعریف قانون مدنی ایراد شده که اولاً تعریف فوق بسیار کلی و عام است، به گونه‌ای که می‌تواند شامل ادله‌ی حکمی مثل متون قانونی نیز شود، زیرا تمام متون قانونی که در روزنامه رسمی منتشر می‌شوند، نوشته هستند و در دعاوی نیز مورد استناد قرار می‌گیرند، در حالی که ادله‌ی حکمی موضوع بحث ادله‌ی اثبات دعوی قرار نمی‌گیرند. ثانیاً بر اساس این ماده دلیلی به نام سند فقط در مقام دعوی یا دفاع قابلیت استناد دارد. در حالی که به طور کلی دلیلیت یک دلیل محدود به اقامه‌ی دعوی نمی‌شود و سند به مجرد اینکه حاوی دلیل باشد دلیل اثبات تلقی می‌گردد، اعم از اینکه در دعاوی خاص به آن استناد شود یا هرگز از آن استفاده نشود. برای رفع ایرادات مزبور سند را باید چنین تعریف کرد: سند عبارت است از نوشته‌ای که حاوی دلیل اثبات موضوعی حق است. واژه «حاوی» نشان‌دهنده این است که خود سند دلیل نیست، بلکه محتوای سند است که دلیل محسوب می‌شود. واژه‌ی «موضوعی» نیز حاکی از این است که محتوای سند باید دلالت بر وجود حقی در عالم خارج نماید و نه حکم آن، بنابراین دلایل حکمی را شامل نمی‌شود.

بخش دوم- انواع سند

در قانون مدنی اسناد به دو دسته تقسیم شده است:

۱- سند رسمی؛

۲- سند عادی (غیررسمی).

مبحث اول- سند رسمی

به موجب ماده ۱۲۸۷ ق.م: «اسنادی که در اداره‌ی ثبت اسناد و املاک و یا دفاتر اسناد رسمی یا در نزد سایر مأمورین رسمی، در حدود صلاحیت آنها و بر طبق مقررات قانونی تنظیم شده باشند رسمی است».

همانطور که در این تعریف مشاهده می‌شود، اسناد رسمی توسط سه دسته تنظیم می‌شوند: اداره‌ی ثبت، دفاتر اسناد رسمی و سایر مأمورین رسمی؛ و هر کدام از این سه دسته باید در حدود صلاحیت خود، که در زیر بررسی می‌شود، اقدام به تنظیم سند رسمی کنند. بنابراین اسنادی که توسط این سه دسته تنظیم نشوند، و یا اینکه در حدود صلاحیت آنها نباشد، سند عادی محسوب خواهند شد.

گفتار اول- انواع سند رسمی از لحاظ مأمور تنظیم‌کننده‌ی سند

۱- اسناد تنظیمی توسط اداره‌ی ثبت اسناد و املاک؛

۲- اسناد تنظیمی توسط دفاتر اسناد رسمی؛

۳- اسناد تنظیمی توسط سایر مأمورین رسمی.

بند اول- تنظیم سند توسط اداره‌ی ثبت اسناد و املاک

هر سندی که در اداره‌ی ثبت اسناد و املاک تنظیم می‌شود سند مالکیت بوده و تابع قانون ثبت اسناد و املاک است.

سازمان ثبت اسناد و املاک کشور با شکل و تشکیلات کنونی در مجموعه نظام اداری کشور تحت نظارت عالیه ریاست قوه‌ی قضائیه و با هدف تثبیت و استقرار حقوق و مالکیت مشروع افراد جامعه و تنظیم روابط مادی و ختم دعاوی ناشی از مراودات اشخاص با یکدیگر و تأمین اعتبار رسمی برای اسناد تنظیمی از طریق اجرای قوانین و مقررات مربوط به ثبت اسناد و املاک، اشتغال دارد. از جمله مهم‌ترین اسناد صادره از سوی ادارات ثبت اسناد و املاک سازمان ثبت، سند مالکیت برای املاک مسکونی از جمله آپارتمانها و نیز املاک مزروعی و بنا و مستحدثات و باغات است.

سندی که در اداره‌ی ثبت اسناد و املاک تنظیم می‌شود سند مالکیت است. تنظیم سند مالکیت تابع قانون ثبت اسناد و املاک است. این قانون طرز انتشار آگهی، نصب پلاک، توزیع اظهارنامه، دادن اظهارنامه، انتشار آگهی نوبتی، انتشار آگهی تهدیدی، سرانجام ثبت ملک را در دفتر املاک شرح می‌دهد. در اداره‌ی ثبت غیر از دفتر املاک، برای ثبت قنوات، ثبت موقوفات، ثبت املاک توقیف شده و املاک مجهول‌المالک نیز دفتری وجود دارد.

- کریمی، عباس، همان، ص ۱۲۷.

- کریمی، عباس، همان، ص ۱۲۵ و ۱۲۶.

- ماده ۱۲۸۶: سند بر دو نوع است: رسمی و عادی.

- کریمی، عباس، همان، ص ۱۳۲.

- حسینی نژاد، حسینقلی، همان، ص ۶۵.

 

موضوعات: بدون موضوع  لینک ثابت
 [ 07:27:00 ق.ظ ]




- تنظیم سند توسط دفاتر اسناد رسمی

علاوه بر اداره‌ی ثبت، اسنادی که در دفاتر اسناد رسمی تنظیم می‌شود رسمی است. قانون، دفاتر اسناد رسمی را دفاتر اسناد رسمی واحد وابسته به وزارت دادگستری می‌داند که برای تنظیم و ثبت اسناد رسمی، طبق قوانین و مقررات مربوط تشکیل می‌شود.

بر اساس ماده ۱ قانون دفاتر اسناد رسمی و کانون سردفتران و دفتریاران «دفترخانه اسناد رسمی واحد وابسته به وزارت دادگستری است و برای تنظیم و ثبت اسناد رسمی طبق قوانین و مقررات مربوط تشکیل می‌شود. سازمان و وظایف دفترخانه تابع قوانین و نظامات راجع به آن است». نمونه‌های مشهور دفاتر اسناد رسمی عبارتند از: دفاتر رسمی اسناد و دفاتر ازدواج و طلاق.

ماده ۴۹ قانون ثبت وظایف سردفتر را معین می‌کند که عبارتند از:

۱- ثبت کردن اسناد مطابق مقررات قانون؛

۲- دادن سواد مصدق از اسناد ثبت شده به اشخاصی که مطابق مقررات حق گرفتن سواد دارند؛

۳- تصدیق صحت امضاء؛

۴- قبول و حفظ اسنادی که امانت می‌گذارند.

بند سوم- تنظیم سند توسط سایر مأمورین رسمی

غیر از اسنادی که در ادارات ثبت اسناد و املاک و دفاتر اسناد رسمی تنظیم می‌شوند، بقیه‌ی اسنادی که توسط مأمورین رسمی تنظیم می‌شود، در این قسم قرار می‌گیرد. مثل شناسنامه، گذرنامه و…

دانلود پایان نامه

تنظیم سند توسط مأمور رسمی، برای رسمی شدن سند کافی نمی‌باشد، و برای اینکه سند رسمی به حساب بیاید باید دارای شرایط زیر باشد:

الف- تنظیم سند بوسیله‌ی سایر مأمورین رسمی دولت

سند زمانی رسمی می‌باشد که بوسیله‌ی مأمور رسمی در مدت مأموریت او تنظیم گردد. منظور از مأمور رسمی کسی است که از طرف مقامات صلاحیت‌دار کشور برای تنظیم سند رسمی معین شده باشد، خواه مستخدم دولت باشد یا غیر مستخدم. بنابراین کسی که به این سمت از طرف مقامات صلاحیت‌دار کشور تعیین نشده و یا از خدمت معاف شده و یا انتظار خدمتش به او ابلاغ گردیده، رسمی شناخته نمی‌شود و اسنادی را که پس از آن تاریخ تنظیم شده‌اند سند رسمی نمی‌باشد، اگرچه کسی هم از رسمی نبودن او آگاه نباشد. اطلاع مأمور به معافیت از خدمت یا انتظار خدمت خود قبل از ابلاغ رسمی آن، موجب سلب صلاحیت او نمی‌گردد و رسمی شناخته می‌شود. همچنین است هرگاه معلوم شود مأمور رسمی در زمان انجام مأموریت، یکی از شرایط استخدام را فاقد بوده است.

مانند کسی که سن لازم برای استخدام را دارا نبوده ولی استخدام شده است، بنابراین عملیات چنین مأموری در حدود مأموریتش صحیح است، اگرچه به علت مزبور هم از خدمت معاف شود.

ب- صلاحیت مأمور در تنظیم سند

مأموری که سند بوسیله‌ی او تنظیم می‌گردد باید صلاحیت تنظیم آن را داشته باشد. این صلاحیت را قانون برای مأمور مشخص نموده است.

صلاحیت مأمور رسمی بر دو قسم است:

۱- صلاحیت نسبی

صلاحیت نسبی عبارت از حدود اختیارات مأمور است نسبت به امری که از طرف مقام صلاحیت‌دار به او محول گردیده، خواه از حیث قلمرو «مکان» یا «زمان» باشد و خواه از حیث «وضعیت حقوقی اشخاصی که سند برای آنان تنظیم می‌گردد». مثلاً کسی که از اداره‌ی آمار و ثبت احوال مأموریت ثبت متوفیات بیگانگان حوزه تهران را دارا می‌باشد، صلاحیت ندارد که در خارج از تهران به ثبت متوفیات بیگانگان بپردازد یا در حوزه تهران متوفیات اتباع ایران را ثبت کند، والا اینگونه اسناد خارج از صلاحیت نسبی مأمور صادر شده است و رسمی محسوب نمی‌گردد.

سمتی که مأمور رسمی نسبت به تنظیم اسناد دارد ناشی از شخصیت او نیست؛ از مأموریتی است که قانون به طور مستقیم یا بوسیله‌ی مقام صالح دیگر به آنان داده است. پس، اگر مأموری معلق از خدمت یا منتظر خدمت یا بازنشسته شود و در آن حال به تنظیم سندی بپردازد، آن سند اعتبار سند رسمی را ندارد و «در صورتی دارای امضاء یا مهر طرف باشد» عادی است. (ماده ۱۲۹۳ ق.م).

اما شرط دیگری نیز در خصوص صلاحیت محلی وجود دارد که کمتر مورد توجه و دقت قرار گرفته و در آن طبیعت مال مورد ثبت از نظر منقول بودن یا غیر منقول بودن، دخالت دارد. طبق قاعده کلی، در خصوص ثبت اموال منقول، صلاحیت مأمور، کافی برای رسمی بودن سند است. مثلاً معاملات مربوط به ماشین پلاک اصفهان می‌تواند در دفترخانه اصفهان ثبت شود. اما در خصوص اموال غیر منقول اینگونه نیست، یعنی باید حتماً در حوزه ثبتی محل وقوع آنها به ثبت برسند.

۲- صلاحیت ذاتی

صلاحیت ذاتی، صلاحیت مأمور است در نوع امری که به او محول گردیده. مثلاً مأموری که برای ثبت دفتر املاک معین شده، آن مأمور فقط برای انجام آن امر صلاحیت دارد و برای انجام امور دیگر مانند ثبت سند در دفتر اسناد رسمی یا تنظیم سجل احوال یا دادرسی صلاحیت نخواهد داشت.

علاوه بر دو شرط مذکور در مورد مأمور تنظیم‌کننده‌ی سند رسمی لازم است دو نکته را یادآور شویم، یکی اعلام عقیده‌ی شخصی مأمور و دیگری تأثیر شرایط قانونی و عمومی برای مأمور رسمی:

ج- اعلام عقیده شخصی مأمور

اظهار مأمور رسمی در صورتی از آن امتیاز استثنائی کامل برخوردار می‌شود که ناظر به رویدادهای مادی و در حدود صلاحیت او باشد. اعلام عقیده شخصی مأمور، به ویژه اگر در صلاحیت و در حدود وظایف او نباشد، ممکن است به عنوان شهادت و در قلمرو ارزیابی دادرس مورد توجه قرار گیرد یا اعلامی تلقی شود که، بدون نیاز به ادعای جعل بتوان خلاف آن را اثبات کرد؛ به عنوان مثال، در وصیت‌نامه یا وقف‌نامه‌ای که بوسیله‌ی سردفتر نوشته می‌شود، او اعلام می‌کند که موصی یا واقف در کمال صحت عقل و رضایت کامل به انشاء عمل حقوقی پرداخته است. ادعای مخالف این گفته، که بر مبنای استنباط سردفتر از ظاهر رفتار شخص امضاءکننده اظهار شده است، نیازی به ادعای جعل ندارد و مدعی حجر موصی یا واقف می‌تواند خلاف آن را بر طبق قواعد عمومی اثبات کند. همچنین است موردی که سردفتر نسبت به مرغوب بودن نمونه‌ی ابراز شده و بهای آن اظهار می‌کند، در حالی که به وظیفه او در تنظیم سند ارتباط ندارد. در این فرض، شهادت او همانند شاهدان عادی است که می‌توان به سادگی خلاف آن را ثابت کرد و سرانجام، دادگاه باید نسبت به اعتبار و ارزش آن تصمیم بگیرد.

- بعضی از دادگاه‌های فرانسه بر آنند که جهل عمومی به آن، عیب سند را جبران می کند. این نظر مطابق اصول قضایی معمول در ایران نمی‌باشد و سندی که او تنظیم نماید رسمی محسوب نمی‌گردد.

صالح احمدی، سعید، مقاله نقش و جایگاه اسناد در ادله‌ی اثبات دعوی در نظام حقوقی ایران،۱۳۸۸.

- صالح احمدی، سعید، همان.

- صالح احمدی، سعید، همان.

- کاتوزیان، ناصر، همان، ص ۲۹۲.

- دیانی، عبدالرسول، ادله‌ی اثبات دعوی در امور مدنی و کیفری، انتشارات تدریس، تهران، چاپ اول، ۱۳۸۵، ص ۱۴۲ و ۱۴۳.

پایان نامه رشته حقوق

- صالح احمدی، سعید، همان.

- یعنی با اینکه جدای از وظیفه‌ی او در تنظیم سند می‌باشد ولی سند رسمی محسوب خواهد شد.

- کاتوزیان، ناصر، همان، ص ۳۰۹.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:26:00 ق.ظ ]




تقسیم بندی اسناد از لحاظ صلاحیت خاص مأموران

بند اول- اسناد قضایی

مانند صورت مجلس‌ها، آراء دادگاه‌ها، معاینه‌ی محلی و تحقیق محلی باز پرسان و تأمین دلیل.

بند دوم- اسناد وابسته و فرا قضایی

مانند صورت مجلس ایداع وجه و اظهارنامه‌ها و ثبت وقایع.

بند سوم- اسناد اداری

مانند قراردادهایی که به شکل اداری بوسیله‌ی شهرداری‌ها تنظیم شده و پروانه‌های ساختمانی و صنفی؛ اسناد مربوط به ثبت احوال شخصی (ازدواج و طلاق و تولد و فوت)، اسناد درج شده در دفاتر ثبت عمومی.

بند چهارم- اسناد تنظیم شده با صلاحیت اداری

مانند اسناد مربوط به اعمال حقوقی که بوسیله‌ی مأموران رسمی ثبت می‌شود: مانند سرپرستی از کودکان بی‌سرپرست و فرزندخواندگی، وصیت‌نامه‌های خودنوشت و سری، اسناد تنظیم شده در دفاتر اسناد رسمی.

گفتار سوم- انواع سند رسمی از لحاظ قدرت اجرائی

از لحاظ قدرت اجرائی، اسناد به دو قسم لازم‌الاجرا و غیر لازم‌الاجرا تقسیم می‌شوند. اسناد رسمی لازم‌الاجرا، اسنادی هستند که قانون به آنها قدرت اجرائی داده است. به این صورت که:

اسناد رسمی خود به خود دارای قوه‌ی اجرائی نیستند، و مانند اسناد عادی در دعاوی مطروحه در دادگستری، از جمله‌ی مستندات اثبات دعوی مورد استفاده قرار می‌گیرد، ولی قانون در مواردی مدلول برخی از اسناد رسمی را بدون مراجعه به محاکم دادگستری و از طریق صدور اجرائیه قابل اجرا دانسته است، به نحوی که ذینفع می‌تواند بدون طرح دعوی و گرفتن حکم، درخواست اجرای آنها را بنماید. از جمله اسناد رسمی مذکور در ماده ۹۲ و ۹۳ ق.ث می‌باشد.

به غیر از اسناد تصریح شده توسط قانون، سایر اسناد رسمی غیر لازم‌الاجرا هستند و نمی‌توان بدون اقامه‌ی دعوی و گرفتن حکم، آنها را اجرا نمود.

گفتار چهارم- تقسیم بندی اسناد از لحاظ شکلی

از حیث نحوه تنظیم و استفاده نیز می‌توان به اسنادی که باید به امضای افراد رسیده یا دارای اثر انگشت ایشان باشد، اسنادی که انتساب آن به صاحب سند باید مسلم باشد، نوشته‌ها و اسنادی که نیاز به امضاء ندارند (مثل دفاتر تجاری)، اسناد عمومی و خصوصی و اسناد تنظیم‌شده در داخل یا در سایر کشورها تقسیم نمود.

مبحث دوم- سند عادی

اسناد عادی را با توجه به تعریفی که قانون مدنی از سند رسمی کرده است می‌توان شناخت.

«غیر از اسناد مذکوره در ماده ۱۲۸۷ سایر اسناد عادی هستند». (ماده ۱۲۸۹ ق.م).

پس در تعریف سند عادی می‌توان گفت: «سندی است که بدون دخالت مأمور رسمی، بوسیله‌ی اشخاص عادی، تنظیم و امضاء می‌شود».

مفهوم مخالف ماده ۱۲۸۷ ق.م این است که اسنادی که بوسیله‌ی مأمورین رسمی، در حدود صلاحیت آنها و طبق مقررات قانونی تنظیم نشده باشد سند عادی محسوب می‌شوند.

ولی تعریفی که کاملتر به نظر می‌رسد این است که: سند در صورتی که بدون دخالت مأمور رسمی، «یا» در غیر حدود صلاحیت آنها و «یا» طبق مقررات قانونی تنظیم نشده باشد، «و» در صورتی که مفاد سند با قوانین ماهوی مخالف نباشد، سند عادی است. به این معنا که سند برای اینکه عادی محسوب شود، کافی است یکی از سه شرط مذکور را نداشته باشد و نیز مفاد آن با قوانین ماهوی مخالف نباشد (ولی موافقت لازم نیست)، چون در صورت مخالفت با قوانین ماهوی، سند باطل است؛ همانطور که سند رسمی هم در این صورت باطل است.

ماده ۱۲۹۳ ق.م یکی از انواع سند عادی را بیان کرده است: «هرگاه سند بوسیله‌ی یکی از مأمورین رسمی تنظیم اسناد، تهیه شده لیکن مأمور، صلاحیت تنظیم آن سند را نداشته و یا رعایت ترتیبات مقرره‌ی قانونی را در تنظیم سند نکرده باشد، سند مزبور در صورتی که دارای امضاء یا مهر طرف باشد، عادی است».

- ماده ۹۲ ق.ث: «مدلول کلیه اسناد رسمی راجع به دیون و سایر اموال منقول بدون احتیاج حکمی از محاکم عدلیه لازم‌الاجراست مگر در مورد تسلیم غیر منقولی که شخص ثالثی متصرف و مدعی مالکیت آن باشد». ماده ۹۳ ق.ث: «کلیه اسناد رسمی راجع به معاملات املاک ثبت شده مستقلاً و بدون مراجعه به محاکم لازم‌الاجراست».

- شیخ نیا، امیرحسین، ادله‌ی اثبات دعوی، شرکت سهامی انتشار، تهران، چاپ سوم، ۱۳۷۵، ص ۹۰.

- کاتوزیان، ناصر، همان، ص ۳۱۷.

- شیخ نیا، امیرحسین، همان، ص ۹۷.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:24:00 ق.ظ ]




مصادیق سند عادی

الف- نوشته‌ای که در روابط حقوقی افراد بوسیله‌ی خودشان و بدون دخالت مأمور رسمی تنظیم می‌نمایند.

ب- اسنادی که توسط مأمور رسمی که صلاحیت ذاتی در تنظیم را ندارد، لیکن سند به امضای طرفین رسیده است.

ج- اسنادی که مأمورین رسمی در حدود صلاحیت خود ولی بدون رعایت تشریفات قانونی تنظیم کرده باشد و طرفین، آن را امضاء کرده باشند.

گفتار دوم- انواع سند عادی

الف- سند عادی گواهی امضاء نشده

اسناد عادی تنوع بیشتری از اسناد رسمی دارد: اوراق تجاری (مانند برات و سفته) و چک، قولنامه‌ها، دفاتر بازرگانی و وصیت‌نامه‌ها، نامه‌های خصوصی و ده‌ها گروه دیگر با نامهای مختلف، مانند بارنامه‌ها، سهام شرکت‌ها و بیمه‌نامه‌ها، توده‌ی بزرگی از اسناد است، که وصف مشترک همه‌ی آنها عدم دخالت مأموران رسمی در تدوین و تنظیم نوشته و احراز تاریخ و اعلامهایی است که در آن آمده و پایه‌ی مهم روابط خانوادگی و تجارتی مردم قرار گرفته است… گواهی امضاء اسناد عادی توسط سردفتر اسناد رسمی اگرچه معمولاً امکان پذیر است اما متداول نمی‌باشد، زیرا با مقرراتی مانند مقررات مالیاتی تعارض پیدا می کند.

ب- سند عادی گواهی امضاء شده

سند عادی که امضای آن از طرف سردفتر گواهی امضاء که سمت رسمی دارد تصدیق شده است، سند عادی می‌باشد؛ در عین حال چون صحت امضای سند را مأمور رسمی گواهی نموده است، این سند به دلالت ماده ۱۲۹۱ ق.م اعتبار سند رسمی را دارد و نمی‌تواند مورد انکار یا تردید قرار گیرد.

گفتار سوم- انواع سند عادی از لحاظ قدرت اجرائی

همانطور که اسناد رسمی به دو قسم لازم‌الاجرا و غیر لازم‌الاجرا تقسیم می‌شوند، اسناد عادی نیز به لازم‌الاجرا و غیر لازم‌الاجرا تقسیم می‌شوند.

هم اسناد رسمی و هم اسناد عادی خود به خود دارای قوه‌ی اجرائی نیستند. همانطور که گفته شد، قانونگذار در مواردی مدلول برخی از اسناد رسمی را بدون مراجعه به محاکم دادگستری لازم‌الاجرا دانسته؛ همچنین ممکن است بنا به مصلحتی سند عادی را قابل اجرا اعلام کند. این اعلام به منزله‌ی رسمی شناختن سند عادی نیست، زیرا وصف جوهری سند رسمی، دخالت مأمور رسمی و رعایت تشریفات تنظیم سند بوسیله‌ی اوست.

پس اسناد عادی لازم‌الاجرا، اسنادی هستند که قانون به آنها قدرت اجرائی داده است.

- شمس، عبدالله، آیین دادرسی مدنی، انتشارات دراک، چاپ هشتم، بهار ۱۳۸۶، جلد سوم، ص ۱۵۵.

- شمس، عبدالله، همان، ص ۱۵۵.

- کاتوزیان، ناصر، همان، ص ۳۱۴.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:23:00 ق.ظ ]




- تفاوت سند رسمی با سند عادی

سند رسمی با غیررسمی در چند جهت با هم فرق دارند:

۱- تفاوت در شکل و مضمون؛

۲- تفاوت در حجیت؛

۳- تفاوت در قدرت اجرائی؛

۴- تفاوت در اعتبار آنها نسبت به اشخاص ثالث؛

۵- تفاوت در اعتبار تاریخ سند؛

۶- تفاوت در قوه‌ی اثباتی.

گفتار اول- تفاوت در شکل و مضمون

اسناد رسمی باید توسط مأمور رسمی و در حدود صلاحیت و بـا رعـایت مقررات و تشریفات در نظر گرفته شده، تنظیم شوند. ولی در اسناد عادی، همینکه شخص مدیون آن را امضاء کـرده بـاشـد، کافی است.

در واقع فقدان تشریفات رسمی و شکلی در تنظیم اسناد از ویژگی‌های اساسی اسناد عادی است.

گفتار دوم- تفاوت در حجیت

دومین تفاوتی که بین اسناد رسمی و اسناد عادی وجود دارد، از لحاظ حجیت و دلیلیت آنها می‌باشد.

اسناد رسمی و اسناد عادی هر دو حجت و دلیل می‌باشند؛ با این تفاوت که در سند رسمی تنها با دعوای جعل و اثبات آن می‌توان خللی در حجیت و اعتبار آن سند وارد کرد. ولی در سند عادی کافی است که شخص منتسب‌الیه صدور خط یا امضای ذیل سند را از خود مورد تردید یا انکار قرار دهد، و یا صحت مندرجات درسند را مورد اشکال قرار دهد. ماده ۷۰ قانون ثبت مقرر می‌دارد: «سندی که مطابق قوانین به ثبت رسیده رسمی است و تمام محتویات و امضاهای مندرج در آن معتبر خواهد بود مگر اینکه مجعولیت آنها ثابت شود».بنابراین مندرجات اسناد رسمی راجع به تعهد به تأدیه وجه یا تسلیم مال یا أخذ تمام یا قسمتی از وجه یا مال قابل انکار نیست. مأمورین قضایی یا اداری که از راه حقوقی یا جزایی انکار فوق را مورد رسیدگی قرار داده و یا به نحوی از انحاء مندرجات سند رسمی را در خصوص رسید وجه یا مال یا تعهد به تأدیه وجه یا تسلیم مال معتبر ندانند، به ۶ ماه تا یک سال انفصال موقت محکوم خواهند شد؛ وبا تردید و انـکار، و یا تشکیک در مندرجات سند نمی‌توان سند رسمی را از اعتبار ساقط نمود. بلکه باید اثبات کرد که مثلاً مأمور رسمی آن را از پیش خود نوشته است. البته در تبصره‌ی این ماده آمده است: «هرگاه کسی که به موجب سند رسمی اقرار به أخذ وجه یا مال یا تأدیه وجه یا تسلیم مالی را تعهد نموده و مدعی شود که اقرار یا تعهد او در مقابل سند رسمی یا عادی یا حواله، برات، چک یا سفته‌ای بوده است که طرف معامله به او داده و آن تعهد انجام نشده است، و یا حواله یا برات یا چک یا سفته پرداخت نگردیده است، این دعوی قابل رسیدگی خواهد بود». (تبصره ماده ۷۰ اصلاحی ق.ث). بدیهی است علت قابلیت رسیدگی به این دعوی، باطل بودن اقرار است که در ماده ۱۲۷۷ ق.م بیان شده است. «انکار بعد از اقرار مسموع نیست، لیکن اگر مقر ادعاء کند که اقرار او فاسد یا مبنی بر اشتباه یا غلط بوده شنیده می‌شود و همچنین است در صورتی که برای اقرار خود عذری ذکر کند که قابل قبول باشد. مثل اینکه بگوید اقرار به گرفتن وجه در مقابل سند یا حواله بوده که وصول نشده، لیکن دعاوی مذکور مادامی که اثبات نشده مضر به اقرار نیست»؛ و در ماده ۷۳ همین قانون، قضات و مأمورین دولتی را موظف به اعتبار دادن به اسناد ثبت شده نموده و در صورت تخلف، آنها را مستوجب تعقیب در محکمه‌ی انتظامی یا اداری دانسته است و در ماده ۲۲ ق.ث.ا.و.ا آمده همینکه ملکی در دفتر املاک به ثبت رسید، دولت فقط کسی را مالک می‌شناسد که سند رسمی به نام وی تنظیم شده است.

- گلدوزیان، ایرج، ادله‌ی اثبات دعوی، نشر میزان، تهران، چاپ اول، ۱۳۸۲، ص ۴۳.

 

- دیانی، عبدالرسول، همان، ص ۱۴۸ به بعد.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:21:00 ق.ظ ]




- تفاوت در قدرت اجرائی

اصل صحت قراردادها و اماره‌ی اصالت اسناد رسمی و اعتمادی که به مأمور رسمی نسبت به رعایت قوانین و تشریفات وجود دارد، باعث شده است که قانونگذار مفاد سند رسمی را قابل اجرا بداند و نیازی به رسیدگی دادگاه و صدور حکم پیدا نکند. در واقع، قدرت اجرائی سند رسمی از آثار اعتبار استثنایی آن است.

پس سند رسمی را می‌توان به اجرا گذاشت و احتیاجی به حکم حاکم ندارد. ولی اجرای سند عادی، متوقف بر حکم دادگاه است.

به موجب ماده ۹۲ ق.ث: «مدلول کلیه اسناد رسمی راجع به دیون و سایر اموال منقول بدون احتیاج حکمی از محاکم عدلیه لازم‌الاجرا است، مگر در مورد تسلیم غیر منقولی که شخص ثالث متصرف و مدعی مالکیت آن باشد».

و ماده ۹۳ ق.ث نیز مقرر می‌دارد: «کلیه اسناد رسمی راجع به معاملات املاک ثبت شده مستقلاً و بدون مراجعه به محاکم لازم‌الاجرا است».

بنابراین با توجه به مدلول مواد فوق ملاحظه می‌گردد که بدون مراجعه به دادگاه و رسیدگی قضایی می‌تواند اجرای مفاد سند را بخواهد، مشروط به اینکه در تصرف شخص ثالث و مدعی مالکیت نباشد. در حالی که، در خصوص اسناد عادی چنین وصفی وجود ندارد، جز در مورد چک که از این جهت، در حکم اسناد لازم‌الاجرا است.

پس سند رسمی، دارای دو طریق برای وصول به حق است: یکی اجرا از طریق محل ثبت و دیگری از طریق دادگاه. ولی اجرای سند عادی فقط متوقف بر حکم حاکم است.

گفتار چهارم- تفاوت در اعتبار آنها نسبت به اشخاص ثالث

اصولاً هیچکدام از اسناد رسمی و اسناد عادی نسبت به اشخاص ثالث اثری ندارند و آثار آنها بر اشخاص ثالث مؤثر نمی‌باشد، مگر اینکه قانونگذار استثنایی قائل شود.

قانونگذار در موارد استثنایی، اسناد رسمی را حتی علیه اشخاص ثالث نیز معتبر و موثر شناخته است. قانونگذار در این باره در ماده ۱۲۹۰ ق.م مقرر می‌دارد: «اسناد رسمی درباره‌ی طرفین و وارث و قائم مقام آنان معتبر است و اعتبار آنها نسبت به اشخاص ثالث در صورتی است که قانون تصریح کرده باشد». به عنوان مثال ماده ۷۲ ق.ث به اعتبار اسناد رسمی نسبت به اشخاص ثالث تصریح کرده است. قبلاً قانونگذار در ماده ۲۳۱ ق.م مال نسبی بودن آثار قراردادها را اثبات اعمال حقوقی همین قاعده را بیان داشته است. لذا، اگر قرارداد فقط نسبت به طرفین و قائم مقام قانونی آنها معتبر باشد، باید اسناد و ادله‌ی اثباتی آنها نیز نسبت به همان طرفین قابل استناد باشد.

گفتار پنجم- تفاوت در تاریخ سند

یکی دیگر از تفاوت‌های اسناد رسمی با اسناد عادی، تفاوت در اعتبار تاریخ تنظیم سند می‌باشد.

در ماده ۱۳۰۵ ق.م در مورد تاریخ اسناد رسمی تأکید بیشتری به عمل آمده است. این ماده مقرر می‌دارد: «در اسناد رسمی تاریخ تنظیم معتبر است حتی بر علیه اشخاص ثالث ولی در اسناد عادی تاریخ فقط درباره‌ی اشخاصی که شرکت در تنظیم آنها داشته و ورثه آنها و کسی که به نفع او وصیت شده، معتبر است».

با توجه به ماده ۸۳۹ ق.م که وصیت مؤخر را معتبر می‌داند، اگر موصی دو وصیت‌نامه‌ی مختلف داشته که اولی رسمی و دیگری غیررسمی باشد، وصیت‌نامه‌ی عادی می‌تواند مقدم بر وصیت‌نامه‌ی رسمی شود، هر چند امری که موجب اعتبار وصیت عادی می‌شود، همان تاریخ آن باشد. بنابراین، موصی‌له در وصیت دوم، به وجود حقی علیه ورثه و یا علیه موصی‌له وصیت‌نامه‌ی اول اقامه نماید، دعوای وی پذیرفته می‌شود؛ زیرا وصیت‌نامه‌ی عادی دوم به دلیل اعتبار تاریخ آن علیه ثالث پذیرفتنی است. دلیل وضع این حکم از طرف قانونگذار این است که به دلیل فوت، امکان مراجعه به موصی وجود ندارد. اما مسئله در جایی که مورد از موارد وصیت و ارث نباشد با اشکال روبرو خواهیم شد. مثلاً اگر شخصی با وکالت بلاعزل که در حکم بیع است، دو عقد مختلف برای انتقال ملکیت منزلی با دو نفر امضاء نماید، فرض این است که در صورت اعتبار هر دو سند، سند اول معتبر است؛ زیرا بیع اول موضوعاً مجالی را برای بیع دوم باقی نمی‌گذارد. ولی امری که موجب اعتبار سند اول می‌شود، تاریخ آن است. حال اگر قرار باشد تاریخ سند عادی نسبت به ثالث، که در مثال فوق می‌تواند خریدار دوم باشد، معتبر نباشد، با مشکلات عدیده‌ای مواجه می‌شویم؛ زیرا تنها امری که موجب اعتبار قرارداد اول بر قرارداد دوم می‌شود، یعنی تاریخ این اسناد، از نظر قانون معتبر نیست. این است که برخی حقوقدانان خود را در مواجهه با این سؤال در بن‌بست قانونی یافته‌اند. گروهی برای حل مشکل با استناد به بند دوم ماده ۱۲۹۱ ق.م معتقدند، چنانچه صحت انتساب سند عادی به صاحب سند توسط دادگاه محرز شد، چنین سندی اعتبار سند رسمی پیدا می‌کند و تاب معارضه با اسناد مخالف خود را خواهد داشت و لذا تاریخ آن نیز مثل سند رسمی، معتبر خواهد بود. اما این پاسخ نیز منطبق بر ماده ۱۲۹۱ ق.م نیست. زیرا بر اساس این ماده، سندی که به این ترتیب اعتبار سند رسمی را پیدا می‌کند، فقط از نظر اعتبار آن نسبت به طرفین، قائم مقام قانونی و ورثه در حکم سند رسمی خواهد بود. مفهوم مخالف ماده فوق این است که اگر فرد تمسک‌کننده به سند، در زمره‌ی طرفین، قائم مقام و یا ورثه نباشد، نمی‌تواند چنین سندی از نظر تاریخ، نسبت به وی معتبر باشد. این است که باید با گروه اول هم‌عقیده شد و این مورد را از بن‌بست‌های قانونی تلقی نمود.

- کاتوزیان، ناصر، همان، ص ۳۱۱.

- صالح احمدی، سعید، همان.

- صالح احمدی، سعید، همان.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:20:00 ق.ظ ]




تفاوت در قوه‌ی اثباتی

تفاوت دیگر سند رسمی با سند عادی، در قوه‌ی اثباتی آنها می‌باشد. به این صورت که:

پایان نامه - تحقیق

سند رسمی، دارای قوه‌ی اثباتی است. قوه‌ی اثباتی یعنی اینکه سند رسمی، خودش، خودش را اثبات می‌کند. هم مفاد و هم تاریخ آن و هم امضاهای آن را اثبات می‌کند؛ و به دلیل دیگری برای اثبات آن، نیاز نیست. بنابراین، سند رسمی هم واجد جنبه‌ی ثبوتی حق است و هم واجد جنبه‌ی اثباتی حق. این معنی از سند رسمی، آن را در عرض حکم قطعی و حکم نهایی دادگاه قرار می‌دهد و می‌توان گفت که دارنده‌ی سند رسمی، معاف از اقامه‌ی دعوی است. در صورتی که سند عادی، به طور کامل دارای این دو جنبه از حق نیست. زیرا در میدان راه اثبات، خود محتاج به دلیل دیگری خواهد بود و اگر مورد انکار و تردید طرف واقع شود و یا مواجه با ادعای جعل گردد و شخص صاحب سند، نتواند دلیل قوی بر اصالت سند و رد ادعای طرف، اقامه کند، این احتمال وجود دارد که سند او از عداد دلایل خارج شود و در نهایت در دعوای خود محکوم شود و به این ترتیب، سند عادی، فاقد جنبه ثبوتی حقی که در آن آمده است نیز خواهد بود. البته، باید دانست که این امتیاز سند رسمی بر سند عادی، مانع از ادعای بی‌اعتباری سند رسمی، خواه به ادعای جعل خواه به ادعای عذر، موجه نیست. ماده ۷۰ ق.ث اصلاحی در ۷/۵/۱۳۱۲ از اعتبار سند رسمی سخن می‌گویند. به موجب این ماده، سندی که مطابق قوانین به ثبت رسیده، رسمی است و تمام محتویات و امضاهای مندرجه در آن، معتبر خواهد بود. مگر اینکه مجعولیت آن سند ثابت شود. انکار مندرجات اسناد رسمی راجع به أخذ تمام یا قسمتی از وجه یا مال و یا تعهد به تأدیه‌ی وجه یا تسلیم مال، مسموع نیست. مأمورین قضایی یا اداری که از راه حقوقی یا جزایی، انکار فوق را مورد رسیدگی قرار داده و یا به نحوی از انحاء، مندرجات سند رسمی را در خصوص رسید وجه یا مال یا تعهد به تأدیه‌ی وجه یا تسلیم مال معتبر ندانند، به شش ماه تا یک سال انفصال موقت محکوم خواهند شد. تبصره‌ی همان ماده که الحاقی و مصوب در ۷/۵/۱۳۱۲ است مقرر می‌دارد: «هرگاه کسی که به موجب سند رسمی، اقرار به أخذ وجه یا مالی کرده یا تأدیه‌ی وجه یا تسلیم مالی را تعهد نموده، مدعی شود که اقرار یا تعهد او را در مقابل سند رسمی یا عادی یا حواله یا برات یا چک یا فته طلبی بوده است که طرف معامله به او داده و آن تعهد انجام نشده و یا حواله یا برات یا چک یا فته طلب پرداخت نگردیده است، این دعوی قابل رسیدگی خواهد بود».

بخش سوم- تاریخچه

ثبت اسناد از گذشته تاکنون سیر تکاملی داشته است و با توجه با ضروریت و کارآمدی که امروزه دارد، به صورت مدون و کنونی در آمده است؛ و در گذشته دارای قدرت و حجیتی که امروزه دارد نبوده است.

از دیرباز انسان در این اندیشه بوده است که محدوده‌ی ملک او مشخص باشد تا از طرفی مورد تعرض دیگران قرار نگیرد و از سوی دیگر با گسترش حریم املاک او مالیات متعلقه برای دولت مشخص باشد. آنگونه که از مطالعات تاریخی بر می‌آید در زمان غارنشینی انسان محدوده‌ی ملک او فقط به دیواره‌ی غارهایی که در آن می‌زیسته منحصر می‌گردیده و با توجه به استفاده مشترک انسانهای اولیه از کوه و دشت و طبیعت، مرزبندی و محدودیتی خارج از محیط غارها مشهود نیست. وجود نقشهای باقی مانده بر دیواره غارها مبین آن است که انسان با زبان تصویر زندگی غارنشینی خود را به ثبت رسانده است. به تدریج با گسترش جوامع انسانی و تشکیل روستاها و شهرها بزرگان اقوام و قبائل و به عبارت دیگر حکومت‌های جوامع به ثبت املاک بیشتر در جهت أخذ مالیات اهتمام ورزیده‌اند.

ثبت املاک سابقه‌ای طولانی دارد و قدیمی‌ترین سندی که در این مورد از حفاری‌های تلو بدست آمده است، مربوط به شهر دودونگی که در کشور کلده است. این سند نقشه شهر دودونگی را در حدود چهار هزار سال قبل از میلاد نشان می‌دهد که اراضی آن به قطعات ذوزنقه، مربع و مثلث تقسیم شده است. داریوش ملقب به کبیر دستور داد تا جمهوری‌های یونانی را در آسیای صغیر ممیزی و اراضی مزروعی را با قید مساحت و اضلاع در دفاتر دولتی ثبت نمایند؛ و چون این روش از جهت تسهیل وصول مالیات اراضی مفید بود. پس از مدتی یونانیان نیز به آن تأسی نمودند و دفاتری برای ثبت خصوصیات اراضی از حیث مساحت و نوع زراعت و میزان محصول و نام مالک ترتیب دادند. در روم قدیم هم سرویوس تولیوس ششمین پادشاه روم دستور داد تا تمام اراضی مزروعی و متعلقات آنها و حقوق ارتفاقی آنها در املاک مجاور و حقوقی که املاک مجاور در آنها دارند در دفتر مخصوصی ثبت شود؛ و هر چهار سال یک مرتبه در آن دفتر تجدید نظر به عمل آید و تغییراتی که در آن مدت در وضع املاک حاصل شده است قید گردد. در روم و آتن دو نوع ثبت وجود داشت ثبت عمومی و ثبت مالی. ثبت عمومی به منظور تعیین آمار افراد و میزان دارایی آنان بکار می‌رفت و به همین جهت املاک هر فرد و قیمت آن معین می‌شد. ثبت مالی برای أخذ مالیات بود و مهندسین ثبتی مساحت هر ملک و حدود آن و وضع ملک (مزروعی، جنگل یا چمنزار و…) و نام مالک و مجاورین را بر پلاک‌های مسی حک می‌نمودند و نقشه‌ی املاک را در دو نسخه تهیه می‌کردند یکی را به مرکز می‌فرستادند تا در دفتر راکد امپراطوری بایگانی شود و دیگری را در دفتر راکد مستملکات حفظ می‌کردند و چون مهندسین و نقشه برداران رومی مستخدم دولت بودند، ثبت رومی‌ها رسمی و در دادگاهها معتبر و دارای سندیت بوده است. هدف اصلی از ثبت املاک در قدیم أخذ مالیات بوده است، ولی در اختلافات و دعاوی هم آن اسناد مورد استفاده قرار می‌گرفته است. در ایران به دستور انوشیروان ثبت معاملات نزد قضات و در دفاتر آنان انجام می‌شد. در عهد صفویه مرجعی به نام دیوانخانه تأسیس شد که یک نفر قاضی شرع در آنجا بکار معاملات و تنظیم اسناد و عقدنامه و طلاق‌نامه می‌پرداخت و اسناد معاملات را مهر و در دفتر مخصوصی ثبت می‌نمود. در کاروانسراها نیز دفاتری به نام دفتر تجارت بود که معاملات تجار را در آن ثبت می‌کردند و این دفتر نزد محاکم دارای اعتبار بود. در اواخر سلطنت فتحعلی شاه و اوایل سلطنت محمدشاه برای جلوگیری از بروز اختلافات تجاری بین ایران و روسیه، دفاتری نزد کارگزاری‌ها وجود داشت که اسناد و معاملات تجار را در آن ثبت می‌کردند. در دو قرن اخیر بسیاری از مراجع دینی دفتری به نام دفتر شرعیات داشتند که خلاصه‌ی معاملاتی را که نزد آنان صورت می‌گرفت در دفتر مذکور درج می‌نمودند و عده‌ای نیز ذیل صفحه‌ی دفتر را تصدیق و در بعضی نقاط طرفین معامله هم ذیل ثبت معامله‌ی خود را امضاء یا مهر می‌کردند.

- صالح احمدی، سعید، همان.

- خسروی، وحید، مختصر تاریخچه ثبت اسناد و املاک در ایران، وبلاگ حقوق ثبت،1390

Hoghooghesabt. Persianblog.ir/podt/16/

- شهری، غلامرضا، حقوق ثبت اسناد و املاک، انتشار جهاد دانشگاهی واحد علامه طباطبایی، تهران، چاپ بیست و سوم ۱۳۸۷، صفحه1-3.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:19:00 ق.ظ ]




 اعتبار سند در فقه امامیه

مبحث اول- دیدگاه فقهی امام خمینی (ره)

در اینجا نظر فقهی امام خمینی (ره) را که در ضمن پرسش و پاسخ‌هایی مطرح شده‌اند مرور می‌کنیم:

سؤال: اگر ملکی دردست یا تصرف شخصی باشد و بعد، چند نفر یا یک نفر مدعی شوند که این ملک، وقف است و نوشته‌ای هم داشته باشند که در آن مرقوم شده که فلان ملک مثلاً وقف است، آیا با ارائه‌ اینگونه نوشته‌ها و ادعاها وقف بودن ثابت می‌شود یا خیر؟

جواب: با ادعا و نوشته وقف ثابت نمی‌شود مگر موجب اطمینان شود.

سؤال: وقف‌نامه‌هایی از دویست، سیصد سال قبل در اداره‌ی اوقاف یا ادارات دیگر، مثل دادگستری، موجود است و فعلاً یک قسمت از چهار قسمت اراضی موقوفه برابر وقف‌نامه مزبور، در تصرف بوده و برای سه قسمت دیگر سند مالکیت صادرشده است. گرچه هنگام تقاضای سند مالکیت وارث، واقف شکایت نموده و مدتها پرونده در جریان بوده، بالاخره ترتیب اثر داده نشده است. با توجه به اینکه طبق مسئله‌ی ۹۲ در (کتاب) تحریرالوسیله، کتاب وقف، فعلاً شیاع مفید علم یا اطمینان (و دیگر راه های اثبات وقف بودن مانند) اقرار ذوالید به تصرف به عنوان موقوفه، و بینه شرعیه (در مسئله‌ی مورد بحث) نیست، تکلیف اراضی مزبور چیست؟

جواب: اگر اراضی مزبور در تصرف وقف نبوده یا معلوم نیست که در تصرف بوده‌اند، تابه طریق شرعی، وقف بودن آنها ثابت نشود حکم وقف ندارند.

سؤال: در قباله ازدواج، بر طبق ماده ۸ قانون حمایت خانواده، چهارده مورد ذکر شده است. در موقع اجرای عقد یا در ضمن عقد لازم دیگر، زوجین شرط می‌کنند که اگر یکی از این چهارده مورد محرز شود زوجه از (طرف) زوج، وکیل یا وکیل در توکیل غیر است که خود را مطلقه نماید. نوعاً این موارد به زوجین تفهیم می‌شود؛ ولی بعضاً زوجین بدون تفهیم، پای ورقه‌ای را که این موارد در آن نوشته شده امضاء می‌کنند. در صورت دوم، اگر یکی از این موارد ثابت شود، آیا زوجه می‌تواند خود را مطلقه نماید یا باید موارد چهارده‌گانه به زوجین تفهیم شود؟

جواب: مجرد امضاء و تفهیم موارد کافی نیست و باید در ضمن عقد، شرط شود یا عقد مبنیاًعلیه واقع گردد.

سؤال: آیا اسناد رسمی مملکتی و یا نوشته‌های عادی که با امضای علمای بزرگ و با مهر آنها ممهور باشد، در فصل خصومت می‌تواند به معنی شاهد یا حجت باشد؟

جواب: اسناد کتبی حجیت شرعیه ندارند مگر آنکه برای قاضی موجب علم باشد.

بنابراین سند تنها در صورتی اعتبار خواهد داشت و از نظر شرع حجیت دارد، که موجب اطمینان قاضی به محتوای سند شود. این امر، مفهومی جدای از اطمینان به صدور سند می‌باشد. در حالی که با دقت در مواد قانونی در میابیم که صدور سند (از طرف مأمور رسمی و در حدود صلاحیت خود و طبق مقررات قانونی) مورد توجه بوده و برای اعتبار سند نقش دارد.

پس، اگر سند ابزاری برای حصول علم قاضی باشد از محل بحث خارج است و جایی برای بحث درباره‌ی تعارض مذکور در ماده ۱۳۰۹ قانون مدنی باقی نخواهد گذاشت و این ماده، از نظر فقهی، اساساً فاقد اعتبار می‌شود.

- کریمی، حسین، موازین قضایی از دیدگاه امام خمینی، انتشارات شکوری، قم، چاپ اول ۱۳۶۵، ص ۱۴۴، مسئله‌ی ۳۱.

- کریمی، حسین، همان، ص ۱۴۶-۱۴۵.

- کریمی، حسین، همان، ص ۱۴۷.

- کریمی، حسین، همان، ص ۱۸۱-۱۸۲.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:17:00 ق.ظ ]




- دیدگاه صاحب جواهر

در اینجا به برخی مندرجات کتاب گرانقدر جواهرالکلام که به آرای دیگر فقها نیز نظر دارد و از معتبرترین متون فقه امامیه است، می‌پردازیم.

دانلود تحقیق و پایان نامه

نویسنده‌ی کتاب جواهرالکلام در مبحث آداب قضا در ضمن مسئله‌ی هفتم، می‌گوید:

«گاه گفته می‌شود:فایده‌ی نوشتن، صرفاً یادآوری ماوقع است والا نوشته حجت شرعی نمی‌باشد و به این ترتیب، هیچیک از این شرایط درباره‌ی نویسنده الزامی نیست. زیرا بدیهی است که اگر با کمک این نوشته اصل مطلب به یاد آورده شد، به استناد همان اصل مطلب، حکم اجرا می‌شود و در غیر این صورت نمی‌توان حکم را جاری کرد، هرچند نوشته دارای اوصاف ذکر شده باشد. البته غالباً همراه با این اوصاف، اطمینانی ایجاد می‌شود که حکم بر مبنای آن اجرا می‌شود».

بر این نظر این اشکال وارد است که فایده‌ی نوشته، تنها در یادآوری آنچه که برای حکم و اجرا موثر است منحصر نمی‌باشد، بلکه گاه فرستادن حکم و امر و نهی و مانند آنها در کار است که امکان زیاد و کم شدن احکام و دستورات یا تغییر آنها وجود دارد، همچنانکه اکنون در مورد نوشته‌های حکمرانان کشورها اینگونه است. بنابراین مقصود این است که اگر قاضی منشی‌ای اختیار کرد که به نگارش او اعتماد داشته و نوشته‌ی وی را ملاحظه نمی‌کند لازم است او چنین صفاتی را دارا باشد، زیرا وی یکی از مصادیق شخص امین محسوب می‌گردد.

صاحب جواهر نوشته را وسیله‌ی حفظ مطالب از تغییرات احتمالی دانسته و آن را وسیله‌ای جهت ثبت یا ابلاغ تلقی کرده است. لذا، به طور تلویحی عدم اعتبار مستقل اسناد را پذیرفته است. آنچه که در نهایت حجت شرعی برای اجرای حکم تلقی می‌شود، اطمینانی است که برای قاضی از دلیل کتبی ایجاد می‌شود و صاحب جواهر به طور ضمنی آن را قبول کرده است.

مبحث سوم- مستندات فقهی حقوقدانان

برخی حقوقدانان برای استدلال بر اعتبار شرعی سند به آیه ۲۸۲ سوره بقره تمسک کرده‌اند. خداوند متعال در این آیه می‌فرماید: «یا أَیهَا الَّذِینَ آمَنُواْ إِذَا تَدَاینتُم بِدَینٍ إِلَی أَجَلٍ مُّسَمًّی فَاکْتُبُوهُ وَلْیکْتُب بَّینَکُمْ کَاتِبٌ بِالْعَدْلِ… فَلْیکْتُبْ وَلْیمْلِلِ الَّذِی عَلَیهِ الْحَقُّ».در این آیه بر مؤمنین تکلیف شده که اگر وامی از کسی می‌گیرند، آن را به صورت مکتوب در آورند؛ و شرط عدالت برای کاتب را ضروری دانسته است. همچنین نویسنده را مکلف به املای دین همراه دقت در نوشتن مطالب نموده است. اگر تکلیف به ثبت دین در این آیه وجود دارد، سند مکتوب مربوط به دین می‌تواند در جایی کارآیی داشته باشد و حجیت و ضرورت آن تنها برای پیشگیری از فراموشی مدنظر قرار نگرفته است. ظاهراً در رابطه با وصیت نیز حکم مشابهی در قرآن کریم وجود دارد. البته از منظر فقه اعتبار سند در چنین صورتی تابع اعتبار اقرار می‌باشد. زیرا چنین سندی با این مشخصات، اقرار به دین محسوب می‌شود. شاید هم علت مسکوت گذاشتن اعتبار سند کتبی به عنوان دلیل، ماهیت اقرار داشتن آن بوده باشد و قانونگذار بحث از اعتبار آن را تکرار مکرر دانسته باشد. همچنین، بنا به حکم عقل که یکی از ادله‌ی استنباط احکام فقهی می‌باشد، باید بی‌تعهدی مردم در جامعه را با بهره گرفتن از تکنولوژی پیشرفته در امر تنظیم اسناد و تربیت افراد مجرب در این امر جبران نمود. امروزه روش‌های بررسی جعل و کشف خدشه به مفاد اسناد روز بروز پیشرفته‌تر می‌شود، لذا نمی‌توان از ارزش اثباتی این دلیل غافل شد و اعتبار آن‌را تنها در قالب اقرار مورد بررسی قرارداد یا شهادت را در اثبات ادعا، قویتر از آن دانست و حکم به بطلان سند رسمی در مقام معارضه با شهادت شهود داد. همچنین دولت‌ها با صرف هزینه‌های بسیار و بکارگیری آخرین دستاوردهای تکنولوژی و تربیت نیروهای متخصص سعی در ارزش دادن روزافزون به اسناد می‌نمایند.

در تمام شرح لمعه که از کتب معتبر حقوق اسلامی می‌باشد در یک جا به موضوع‏ سند می‌رسیم تازه آن هم برای کتابت و حفظ اقرار می‌باشد: و لو التمس المدعی کتابه اقراره کتب و اشهد مع معرفته او شهاده عدلین او اقتناعه بحلیته یعنی اگر مدعی، کتابت‏ اقرار مدعی علیه را از حاکم بخواهد نوشته می‌شود و حاکم یا دو شاهد عادل آن را گواهی می‌نمایند و یا زیور و زینت یعنی هیئت ظاهر مدعی علیه (بجای گواهی حاکم‏ و عدلین) در ذیل اقرارنامه نوشته شده و بدان اکتفا می‌شود. پس در حقوق اسلامی‏ سند بالاستقلال جزء ادله اثبات دعوی نیست بلکه برای تثبیت شهادت و اقرار تحریر و تنظیم می‌یابد.

برخی دیگر از حقوقدانان به سندهای وقف‌نامه که برخی علمای دینی بر طبق آنها نظر داده و عمل کرده‌اند، استناد جسته‌اند.

- نجفی، محمدحسن، جواهرالکلام فی شرح شرایع الاسلام، دارالکتب الاسلامیه، تهران، چاپ سوم، ۱۳۹۸ ه. ق، جلد ۴۰، ص ۱۱۰-۱۰۹.

- دیانی، عبدالرسول، همان، ص ۱۳۷- ۱۳۸.

- یاری، بهرام، سند و تاریخچه آن (اسناد رسمی و اعتبار و قدرت اجرائی آن)، مقاله، مجله کانون وکلا، ۱۳۴۵، شماره ۱۰۲.

- جعفری لنگرودی، محمدجعفر، علم آزاد در گردش ادله‌ی اثبات دعوی (در حقوق اسلام)، انتشارات گنج دانش، تهران، ‌چاپ ششم، 1382. ص ۷۶-۷۸.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:16:00 ق.ظ ]




اعتبار اسناد رسمی

مبحث اول- شرایط اعتبار اسناد رسمی

برای معتبر بودن اسناد رسمی شرایطی لازم است که عبارتند از:

۱- تنظیم سند بوسیله‌ی مأمور رسمی؛

۲- ذیصلاح بودن مأمور رسمی در تنظیم سند؛

۳- رعایت مقررات قانونی در تنظیم سند (رعایت قوانین شکلی راجع به سند)؛

۴- مخالف نبودن مفاد سند با قوانین ماهوی؛

۵- مخالف نبودن سند با نظم عمومی و اخلاق حسنه.

گفتار اول- تنظیم سند بوسیله‌ی مأمور رسمی

برای اینکه نوشته‌ای رسمی محسوب شود، باید در اداره‌ی ثبت اسناد و املاک یا در دفاتر اسناد رسمی و یا بوسیله‌ی سایر مأمورین رسمی تنظیم شود، که جزئیات آنها قبلاً بررسی شد.

دانلود تحقیق و پایان نامه

پس هرگاه نوشته‌ای یکی از این سه شرط را نداشته باشد، آن نوشته در صورتی که دارای مهر یا امضای طرف باشد، و شرایط اعتبار اسناد عادی (که در همین فصل به آنها می‌پردازیم) را داشته باشد، عادی محسوب می‌شود.

گفتار دوم- ذیصلاح بودن در تنظیم سند

تنظیم‌کننده‌ی سند باید در حدود صلاحیتی که دارد اقدام به تنظیم سند بکند (اعم از صلاحیت ذاتی و صلاحیت محلی). صلاحیت ذاتی به این صورت است که مثلاً اگر سردفتر ازدواج، معامله‌ی خانه را ثبت کند، این سند رسمی نیست، چون سردفتر ازدواج فقط ذاتاً صلاحیت ثبت ازدواج را دارد. در مورد صلاحیت محلی هم به این صورت است که اگر سردفتر ازدواج یا طلاق دفتر ثبت وقایع را از شهری که برای تنظیم، سندیت دارند خارج کند و برای تنظیم سند به شهر دیگر ببرد، این سند، سند لازم‌الاجرا و رسمی تلقی نمی‌شود، چون سردفتر برخلاف صلاحیت محلی‌اش عمل کرده است. سردفتر اسناد رسمی نمی‌تواند بدون کسب مجوز دفتر خود را از اتاقش خارج بکند، مگر با اجازه‌ی مقامات صالحی که در قانون مقرر گردیده است؛ و اگر چنین کاری را بدون مجوز انجام دهد، چون خلاف صلاحیت محلی خود عمل کرده است، سند مذکور رسمی تلقی نمی‌شود.

گفتار سوم- رعایت مقررات قانونی در تنظیم سند

برای اینکه سندی رسمی محسوب شود، مقررات و تشریفاتی که قانون در تنظیم سند لازم می‌داند، باید در آن رعایت شده باشد. این تشریفات در زیر بررسی می‌شوند.

بند اول- تشریفات تنظیم اسناد رسمی

الف- تشریفاتی که سند را از رسمیت نمی‌اندازد، ولی قوه‌ی اجرائی آن را می‌گیرد. مانند عدم الصاق تمبر، چنانکه ماده ۱۲۹۴ ق.م مقرر می‌دارد: «عدم رعایت مقررات راجعه به حق تمبر که به اسناد تعلق می‌گیرد سند را از رسمیت خارج نمی‌کند».

ب- تشریفاتی که عدم رعایت آن، سند را از رسمیت می‌اندازد. در صورتی که در تنظیم سند، تمام تشریفاتی را که قانون و یا آئین‌نامه‌ای که به دستور قانون تهیه شده در تنظیم سند لازم بداند، رعایت شود، سند رسمی محسوب می‌شود، مگر آنکه قانون صریحاً متذکر شود که عدم رعایت یکی از تشریفات معینه، سند را از رسمیت می‌اندازد. بنابراین سند وقتی رسمی شناخته می‌شود که شرایط مذکوره در فوق را دارا باشد و هرگاه سند بوسیله‌ی مأمور غیررسمی تنظیم گردد و یا بوسیله‌ی یکی از مأمورین رسمی تنظیم شود که صلاحیت تنظیم آن را نداشته باشد و یا یکی از تشریفات مقرر قانونی در تنظیم سند رعایت نشده باشد، سند مزبور در صورتی که دارای امضاء یا مهر طرف باشد سند عادی شناخته می‌شود و آثار مترتبه بر آن را دارا خواهد بود. سندی که در ظاهر دارای شرایط اساسی قانونی می‌باشد، رسمی فرض می‌گردد تا آنکه ثابت شود که فاقد یکی از شرایط اساسی می‌باشد، ادعای مزبور بوسیله‌ی هر نوع دلیلی قابل اثبات می‌باشد.

پس عدم رعایت برخی از مقررات و تشریفات شکلی، سند را از رسمیت و قوه‌ی اجرائی می‌اندازد و نیز برخی از اسناد را از سندیت می‌اندازد. جایی که سند از سندیت می‌افتد مانند جایی است که مفاد سند مخالف با قوانین باشد، که در زیر بررسی می‌شود.

Public order -[1]

- امامی، سید حسن، حقوق مدنی، انتشارات اسلامیه، تهران، چاپ دوازدهم، ۱۳۸۷، جلد ۶، ص ۷۶ به.

- بر اساس ماده ۱۲۹۳ ق. م.

- امامی، سید حسن، همان، ص ۷۶ به.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:14:00 ق.ظ ]




- اصل محلی بودن قانون مربوط به تنظیم سند

اصل حکومت قانون محلی را، درباره‌ی طرز تنظیم سند، همه قوانین پذیرفته‌اند، چندانکه می‌توان آن را قاعده‌ی بین‌المللی شمرد. ماده ۹۶۹ ق.م نیز در این باره صریح است: «اسناد از حیث طرز تنظیم تابع قانون محل تنظیم خود می‌باشند». پس اگر قانون محل تنظیم سند عادی حکم کند که، علاوه بر امضای سند، هر یک از دو طرف معامله باید جمله‌ای را به خط خود در آن بنویسند، این حکم باید رعایت شود، هر چند که در کشور اجراکننده‌ی مفاد سند این شرط ضروری نباشد، همچنین، اگر سند رسمی در کشوری تنظیم شود که تشریفات آن ساده‌تر از قانون حاکم در محل اجرای سند باشد، رعایت قانون محلی برای رسمی شدن سند کافی است. این قاعده را ضرورت‌های بین‌المللی مربوط به تعارض قوانین توجیه می‌کند، زیرا احتمال دارد اجرای تشریفات یا دخالت مقامهای پیش‌بینی شده در محل رسیدگی به دعوی در محل تنظیم سند ممکن نباشد و این امر سبب تعذر تنظیم سند معتبر شود.

دانلود تحقیق و پایان نامه

گفتار چهارم- مخالف نبودن مفاد سند با قوانین ماهوی

ماده ۱۲۸۸ ق.م می‌گوید: «مفاد سند در صورتی معتبر است که مخالف قوانین نباشد».

موافقت سند با قانون از نظر مفاد و معنی آن است که مدلول سند با قانون مخالف نباشد، مثلاً تعهد نباید متضمن امر محال باشد که در این صورت این تعهد باطل است.

بنابراین، اگر مفاد سندی ناظر به اثبات معامله‌ای باشد که موضوع آن فروش انسان یا تسهیل استفاده نامشروع از جسم آدمی یا فروش عین موقوفه باشد، چنین سندی باطل است. همچنین است چنانچه سندی دال بر اقرار باشد ولی نحوه‌ی تقریر آن به گونه‌ای باشد که آن را معلق گرداند، در اینجا بطلان سند به مفاد و مضمون آن بر می‌گردد نه به شرایط صوری مربوط به تنظیم آن. البته، شرط عدم مخالفت با قانون تنها از شرایط سند رسمی نیست، بلکه سند عادی نیز باید چنین شرطی را دارا باشد.

گفتار پنجم- مخالف نبودن سند با نظم عمومی و اخلاق حسنه

یعنی اینکه مفاد اسناد نباید با اخلاق افراد محسن جامعه که همان افراد متعارف جامعه هستند مغایر باشد. منظور از اینکه اسناد مخالف نظم عمومی و اخلاق حسنه نباشد این است که، محتوا و مضمون اسناد نباید مخالف نظم عمومی و اخلاق حسنه باشد، چرا که خود سند قابلیت مخالفت با نظم عمومی و اخلاق حسنه را ندارد.

مبحث دوم- حدود اعتبار اسناد رسمی

حدود اعتبار دلیل سند را قانون مقرر داشته است. منظور این است که سند اعتبار مطلق ندارد و به علت مواجه شدن اسناد با یکدیگر، ممکن است از رفتار دلیل سند کاسته شود و حتی سند از عنوان سند بودن ساقط شود و بدین ترتیب، دلیل محسوب نشود. چنانکه ممکن است سند بر نفع صاحب آن دلیل نباشد و بر ضرر او دلیل باشد. این را باید به معنی کاهش اعتبار دلیل سند یا کاهش بار دلیل سند دانست. در مورد تعارض اسناد رسمی با یکدیگر، دو یا چند سند رسمی در تعارض با یکدیگر قرار می‌گیرند و سندی صحیح و معتبر تشخیص داده می‌شود و سند یا اسناد دیگر، از مرتبه‌ی سند بودن سقوط می‌کند و حتی سند عادی هم محسوب نمی‌شود.

گفتار اول- اعتبار محتویات سند رسمی

عبارات، امضاها، مهرها و اثر انگشت‌هایی که در سند نوشته یا گذاشته می‌شود را محتویات سند می‌گویند. به موجب ماده ۷۰ ق.ث: «سندی که مطابق قوانین به ثبت رسیده رسمی است، تمام محتویات و امضاهای مندرجه در آن معتبر خواهد بود، مگر آنکه مجعولیت آن سند ثابت شود…».بر اساس این ماده منظور از رعایت محتویات سند رسمی، فرض صحت انتساب محتویات مزبور به اشخاصی است که این محتویات به آنها منسوب است. در نتیجه اگر در سندی رسمی امضاء، مهر، یا اثر انگشت و یا عبارتی وجود داشته باشد که منتسب به متعاملین است و سپس منتسب‌الیه انتساب امضاء، مهر، اثر انگشت و یا عبارات مزبور را به خود انکار نماید، انکار او پذیرفته نیست و تنها می‌تواند با ذکر دلیل، نسبت به آن سند ادعای جعلیت نماید.

بنابراین چنانچه کسی برای اثبات ادعای خود نسبت به دیگری در دادگاه به سند رسمی استناد نماید، طرف نمی‌تواند در انتساب عبارات مندرجه در آن سند و همچنین امضاهایی که در آن به اشخاص معینی نسبت داده شده تردید و یا تکذیب نماید، خواه اشخاص مزبور از مأمورین رسمی باشند یا متعاملین؛ لذا هرگاه طرف ادعا کند که امضاء از ناحیه او صادر نشده و یا آنکه جمله مندرجه در سند به کسی که نسبت داده شده از گفتار او نیست و یا آنکه نخوانده سند را امضاء نموده است مسموع نخواهد بود، مگر آنکه نسبت به آن دعوای جعلیت نماید و دلیلی بر اظهارات خود ابراز کند، زیرا رعایت تشریفاتی که قانون در تنظیم سند رسمی لازم دانسته، موجب فرض صدور انتساب محتویات و امضاهای در سند به اشخاصی است که به آنها نسبت داده شده است تا آنکه خلاف آن ثابت گردد؛ در ماده ۱۲۹۲ ق.م در این زمینه آمده است: «در مقابل اسناد رسمی یا اسنادی که اعتبار اسناد رسمی را دارد انکار و تردید مسموع نیست و طرف می‌تواند ادعای جعلیت نسبت به اسناد مزبور کند یا ثابت کند که اسناد مزبور به جهتی از جهات قانونی از اعتبار افتاده است».بنا بر آنچه گفته شد هرگاه سند رسمی در دعوایی ابراز و استناد گردد، بدون رسیدگی به صحت صدور، محتویات آن معتبر می‌باشد و احتیاجی به اقامه‌ی دلیل از ناحیه ابرازکننده بر صحت انتساب و صدور محتویات آن نخواهد بود به خلاف سند عادی که نمی‌توان آن را معتبر دانست مگر آنکه دلیل بر انتساب و صدور محتویات آن از ناحیه‌ی استنادکننده ابراز گردد. به همین خاطر است که طرف می‌تواند در مقام دفاع به تکذیب یا تردید اکتفا کند.

- کاتوزیان، ناصر، همان، ص ۲۸۶.

- حسینی نژاد، حسینقلی، همان، ص ۶۸.

- دیانی، عبدالرسول، همان، ص ۱۴۲.

- کریمی، عباس، همان، ص ۱۳۸.

- حمیتی واقف، احمدعلی، ادله‌ی اثبات دعوی، انتشارات دانش نگار، تهران، چاپ اول ۱۳۸۷، ص ۸۸ به بعد.

- شمس، عبدالله، همان، ص ۱۴۴.

- امامی، سید حسن، همان، ص ۸۰.

جایگاه سند در ادله‌ی اثبات دعوی

موضوعات: بدون موضوع  لینک ثابت
 [ 07:13:00 ق.ظ ]




اعتبار مندرجات سند رسمی

محتویات سند از امور مادی است ولی مندرجات سند از امور معنوی می‌باشد. یعنی مفاد عباراتی که در سند قید شده اختلاف راجع به سند رسمی منحصر به سند انتساب محتویات سند نمی‌باشد، بلکه ممکن است پس از ابراز سند رسمی از ناحیه کسی در دادگاه، طرف او تسلیم به صحت شود که عبارت و اظهاراتی که نسبت به مأمور رسمی و یا اشخاص دیگر داده شده از آنها صادر گردیده است، ولی برخلاف واقع می‌باشد و دلیل هم بر گفته‌ی خود اقامه نماید. آیا دعوای مزبور قابل رسیدگی است؟ برای پاسخ به پرسش فوق قبلاً باید وضعیت مندرجات سند رسمی تشریح گردد.

بند اول- وضعیت مندرجات سند رسمی
الف- اعلامیات مأمور رسمی

اعلامیات مأمور رسمی، به قسمتی از مندرجات سند که مأمور رسمی از مشهودات و محسوسات خود اعلام نموده است را می‌گویند. اعتبار اعلامیات رسمی از مسئولیت شدیدی است که در انجام مأموریت خود در مقابل قانون دارد و این امر موجب شده است قانون فرض صحت عملیات او را در حدود وظایف محوله، قانونی بنماید. بنابراین آنچه سردفتر از مشهودات و محسوسات خود مانند هویت متعاملین، تاریخ ثبت سند و امثال آنکه در حدود مأموریت رسمی که دارد در سند قید می کند، فرض می‌شود که حقیقت می‌باشد، مگر آنکه جعلیت آن ثابت گردد. مثلاً چنانچه در سند فروش خانه، تنظیمی در دفتر اسناد رسمی، قید شده باشد که مشتری نقداً ثمن را به بایع تسلیم نماید، تسلیم ثمن از طرف مشتری به بایع مسلم خواهد بود، مگر آنکه بایع دعوای جعلیت آن قسمت را کند و ثابت نماید که مأمور رسمی ثمن را قید نموده است. بنابراین انکار بایع از دریافت ثمن بلا اثر خواهد بود. قسمت دوم ماده «۷۰» اصلاحی قانون ثبت: «… انکار مندرجات اسناد رسمی راجع به أخذ تمام یا قسمتی از وجه یا مال یا تعهد به تأدیه یا تسلیم مال مسموع نیست…». اطلاق ماده «۱۲۹۲» ق.م: «در مقابل اسناد رسمی یا اسنادی که اعتبار رسمی دارد انکار و تردید مسموع نیست و طرف می‌تواند ادعای جعلیت به اسناد مزبور کند یا ثابت نماید که اسناد مزبور به جهتی از جهات قانونی از اعتبار افتادهاست». ممکن است از توجه به مفاد ماده ۱۲۹۲ ق.م گمان شود که فقط برای اثبات خلاف اعلامیات مأمور رسمی از مندرجات سند، باید دعوای جعلیت نمود و یا ادعاء کرد که سند به جهتی از جهات مانند اقاله و فسخ از اعتبار افتاده است دعوای اشتباه مسموع نمی‌باشد و حال آنکه فرض اشتباه ممکن است، ولی از آنجا که اعتبار اعلامیات مأمور رسمی از مندرجات سند فقط از لحاظ فرض صحتی می‌باشد که قانون برای عملیات مأمورین رسمی قائل شده است و این اماره قانونی تا زمانی که خلاف آن ثابت نشده معتبر است و بوسیله‌ی هر دلیلی که قانون صراحتاً منع ننموده باشد می‌توان برخلاف آن را ثابت کرده و فقط قانون، شهادت و اماره‌ی قضایی را در مقابل سند رسمی معتبر ندانسته است و آنچه از ماده ۱۲۹۲ ق.م استنباط می‌شود و هرگاه کسی که سند علیه اوست آن را خلاف واقع می‌داند می‌تواند آن را اثبات نماید. بنابراین دعوای اشتباه با ابراز دلیل نیز پذیرفته می‌باشد، زیرا در صورت عدم قبول چنین دعوایی، بایستی بر آن بود که قانونگذار فرض اشتباه بر عملیات مأمورین خود ننموده است و این امر مخالف منطق می‌باشد و پذیرفتن دعوای اشتباه منافاتی با منظور قانونگذار که موجب فرض صحت عملیات مأمورین گردیده، ندارد و با توجه به اینکه کلیه امارات قانونی طبق ماده ۱۳۲۳ ق.م معتبر می‌باشد مادام که خلاف آن ثابت نشده باشد و به طور صریح هم قانون پذیرفتن دعوای خلاف مندرجات سند رسمی را منع ننموده است برای قبول دعوای اشتباه در مقابل سند رسمی مانعی وجود ندارد.

- امامی، سید حسن، همان، ص ۸۰ به بعد.

- امامی، سید حسن، همان، ص ۸۰ به بعد.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:11:00 ق.ظ ]




- اعلامیات افراد

قسمتی از مندرجات سند که حاکی از اظهارات افراد در حضور مأمور رسمی می‌باشد را گویند. مشهودات و یا محسوساتی که مأمور رسمی در سند منعکس می کند و قانون مأمور رسمی را موظف به نوشتن آن ننموده است در حکم این اعلامیات می‌باشد، زیرا نوشتن آن خارج از حدود وظایف مأمور رسمی می‌باشد. همانطور که گفته شد اعتبار اعلامیات مأمور رسمی از لحاظ اعتماد بر عملیات مأمورین رسمی می‌باشد که قانون فرض صحت آن را نموده است و بدین جهت جز بوسیله‌ی دعوای جعلیت نمی‌توان خلاف آن را اثبات نمود. ولی اعتبار اعلامیات افراد از نظر اعتباری است که اقرار آنها دارا می‌باشد والا نوشتن آن امور بوسیله‌ی مأمور رسمی واقعیت آن را تغییر نمی‌دهد، بنابراین مسئولیت صحت اعلامیات افراد به عهده‌ی خود آنان است و مأمور رسمی هیچگونه وظیفه‌ی تحقیق در صحت و سقم آن و همچنین مسئولیتی در عدم مطابقت آن واقع ندارد. سردفتر اسناد رسمی اظهارات متعاملین را چنانچه برخلاف قانون و نظم عمومی و اخلاق حسنه نباشد در سند می‌نویسد و در دفتر ثبت می کند. این است که هرگاه کسی مدعی شود آنچه از طرف متعاملین اظهار شده است و در سند قید گردیده است به جهتی از جهات برخلاف حقیقت می‌باشد، می‌تواند آن را بدون آنکه دعوای جعلیت کند اثبات نماید. به عبارت دیگر اعلامیات افراد از مندرجات سند رسمی، اقرار کتبی آنان به اموری است که خارج از حضور مأمور رسمی اتفاق افتاده و بوسیله‌ی مأمور رسمی ثبت گردیده است و به دستور ماده ۱۲۸۰ ق.م: «اقرار کتبی در حکم اقرار شفاهی است». بنابراین، الف: پذیرفتن دعوای خلاف اعلامیات افراد- ممکن است اعلامیات افراد فاسد و یا مبتنی بر اشتباه و غلط باشد و یا در مقابل امری بوده که انجام نشده است. پذیرفتن دعوای خلاف از طرف اعلام‌کننده و قائم مقام او و همچنین از طرف اشخاص ثالث مانعی نخواهد داشت، زیرا از نظر تحلیلی، اعلامیات افراد از مندرجات سند، اقرار کتبی خارج از دادگاه به شمار می‌رود که در حضور مأمور رسمی به عمل آمده و در دفتر رسمی ثبت شده است و اصولاً دعوای برخلاف اقرار قابل پذیرش است و اعلام در حضور مأمور رسمی و امضاء اعلام‌کننده و یا ثبت آن در دفتر رسمی، اعلام‌کنندگان را بیشتر متوجه به عواقب قانونی اعلامیات خود می کند و جدیتر آن را تلقی می‌نمایند. بنابراین چنانچه ذینفع خواه از طرفین و قائم مقام آنها باشد و خواه از اشخاص ثالث، دلیل برخلاف اعلامیات افراد داشته باشد، می‌تواند با ابراز آن در دادگاه صالح اقامه‌ی دعوای نماید و هرگاه ثابت گردید در آن قسمت طبق آنچه ثابت شد اعلام می‌شود. بنا بر آنچه گذشت از ماده ۱۲۷۷ قانون مدنی و تبصره ماده ۷۰ اصلاحی ق.ث، مفهوم می‌شود ذینفع می‌تواند ادعا نماید اقراری را که در حضور مأمور رسمی به عمل آمده فاسد و یا مبتنی بر اشتباه و غلط بوده و همچنین است در صورتی که برای اقرار عذری ذکر کند که قابل قبول باشد، چنانچه یکی از طرفین مدعی شود که اقرار به اخذ وجه یا مالی که شده است و یا تعهد به تسلیم مال یا وجهی را که گردیده است به طور ساده نبوده، بلکه آن اقرار و تعهد در مقابل سند رسمی یا عادی و یا حواله و یا برات و یا چک یا سفته پرداخت نگردیده است. ماده ۱۲۷۷ قانون مدنی می‌گوید: «انکار بعد از اقرار مسموع نیست لیکن اگر مقر ادعاء کند که اقرار او فاسد یا مبنی بر اشتباه یا غلط بوده شنیده می‌شود و همچنین است در صورتی که برای اقرار خود عذری ذکر کند که قابل قبول باشد؛ مثل اینکه بگوید اقرار به گرفتن وجه در مقابل سند یا حواله بوده که وصول نشده لیکن دعاوی مذکوره مادامی که اثبات نشده مضر به اقرار نیست». تبصره ماده ۷۰ اصلاحی ق.ث: «هرگاه کسی به موجب سند رسمی اقرار به اخذ وجه یا مالی کرده یا تأدیه وجه یا تسلیم مالی را تعهد نموده مدعی شود که اقرار یا تعهد او در مقابل سند رسمی یا عادی یا حواله یا برات یا چک یا فته‌ی طلبی بوده است که طرف معامله به او داده و آن تعهد انجام نشده، یا حواله، یا برات یا چک یافته طلب پرداخت نگردیده است این دعوی قابل رسیدگی خواهد بود».

تحقیق - متن کامل - پایان نامه

- امامی، سید حسن، همان، ص ۸۰ به بعد.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:10:00 ق.ظ ]




دعوای مخالف مندرجات سند رسمی

ماده ۱۳۰۹ ق.م می‌گوید: «در مقابل سند رسمی یا سندی که اعتبار آن در محکمه، محرز شده، دعوایی که مخالف با مفاد یا مندرجات آن باشد به شهادت اثبات نمی‌گردد».

و ماده ۱۳۲۴ ق.م می‌گوید: «اماراتی که به نظر قاضی واگذار شده عبارت است از اوضاع و احوالی در خصوص مورد و در صورتی قابل استناد است که دعوی به شهادت شهود قابل اثبات باشد یا ادله‌ی دیگر را تکمیل کند».

با توجه به این دو ماده، دعوای مخالف مندرجات سند رسمی با اماره یا با شهادت شهود، قابل اثبات نمی‌باشد ولی بوسیله‌ی دلایل دیگر می‌تواند اثبات شود.

پایان نامه - تحقیق - متن کامل

بند سوم- بی‌اعتباری و بطلان رأی داور در موارد مخالفت با مندرجات سند رسمی

طبق بند ۵ ماده ۴۸۹ قانون آیین دادرسی دادگاههای عمومی و انقلاب در امور مدنی «اگر رأی داور با آنچه بین اصحاب دعوی در دفتر اسناد رسمی ثبت شده و دارای اعتبار قانونی است مخالف باشد باطل است».

گفتار سوم- نسبی بودن اعتبار سند

بند اول- اعتبار اسناد نسبت به اشخاص ثالث، طرفین و قائم مقام آنها

اعتبار سند، چه از نظر ماهوی و چه از لحاظ اثباتی، محدود به کسانی می‌شود که در تدوین و تنظیم و امضای سند دخالت داشته‌اند، چون به طور معمول سند وسیله‌ی اثبات وقوع اعمال حقوقی است و اثر اعمال حقوقی نیز نسبی و محدود به اشخاصی است که در وقوع آنها دخالت داشته‌اند. ماده ۱۲۹۰ ق.م در مورد اسناد رسمی به بیان اصل نسبی بودن اعتبار سند می‌پردازد. در این ماده آمده است: «اسناد رسمی درباره‌ی طرفین و وراث و قائم مقام آنان معتبر است و اعتبار آنها نسبت به اشخاص ثالث در صورتی که قانون تصریح کرده باشد». بدیهی است که حکم ماده ناظر به اعتبار سند و توان اثباتی آن است نه مفاد و آثار قراردادی که در سند اعلام شده است. وصف «رسمی بودن سند» در متن ماده بیان شده است مانع از رعایت آن در اسناد عادی نمی‌شود. زیرا، در ماده ۱۲۹۱ نیز اعتبار اسناد عادی محدود به طرفین و وراث و قائم مقام آنان شده است. لیکن، اگر سند رسمی، که بخشی از آن نزد مأمور رسمی یا بوسیله‌ی او تنظیم می‌شود، درباره‌ی دیگران اثر نداشته باشد، به طریق اولی اعتبار سند عادی باید محدود بماند و به حکم طبیعت خود به اشخاص ثالث سرایت نکند. بنابراین، باید پذیرفت که اصل نسبی بودن اعتبار از قواعد عمومی اعتبار اسناد است و اختصاص به سند رسمی ندارد. منتها، چون امکان استناد به سند رسمی برای اثبات امری در برابر اشخاص ثالث بیشتر است و امکان دارد که در اصل نسبی بودن آنها تردید شود، قانونگذار ترجیح داده است که اصل را در این زمینه اعلام کند. به عنوان مثال، تاریخ تنظیم سند رسمی بوسیله‌ی دادگاه صالح و عمومی اعلام و در دفاتر رسمی ثبت می‌شود و در اختیار دو طرف معامله یا شخص معینی (مانند موصی یا اقرارکننده) نیست تا تاریخ دلخواه را بر آن نهند، پس اعتبار تاریخ سند رسمی در برابر دیگران نیز با استقلال آنان و طبیعت نوعی آن منافات ندارد؛ در حالی که تاریخ سند عادی چنین وضعی ندارد و در برابر اشخاص نوعی ادعاست. ماده ۱۳۰۵ ق.م بر پایه همین تفاوت، درباره‌ی اعتبار تاریخ سند اعلام می‌کند: «در اسناد رسمی تاریخ تنظیم معتبر است حتی علیه اشخاص ثالث ولی در اسناد عادی تاریخ فقط درباره‌ی اشخاصی که شرکت در تنظیم آنها داشته و ورثه آنان و کسی که به نفع او وصیت شده معتبر است». واژه‌ی اعتبار با قابلیت استناد اندکی تفاوت دارد. واژه‌ی اعتبار هم ناظر به مرحله‌ی ثبوت است و به آثار حقوقی و ماهوی عمل حقوقی توجه ندارد. سند، چه رسمی باشد و چه عادی، از نظر اثبات واقعه‌ای که در آن اعلام شده در برابر اشخاص ثالث نیز قابل استناد است و این چهره‌ی اعتبار محدود به کسانی نمی‌شود که در تنظیم سند دخالت داشته‌اند. به عنوان مثال، اگر در سندی آمده باشد که خواهان ملکی را از شهرداری خریده است، این سند در برابر متصرفی که مدعی مالکیت است قابل استناد به نظر می‌رسد و از جهت اثبات وقوع معامله میان شهرداری و خواهان معتبر است، هر چند که از لحاظ اثبات مالکیت شهرداری در برابر مدعی اعتباری نداشته باشد. همچنین، نکاح‌نامه‌ی زن و شوهر در برابر هر بیگانه برای اثبات وقوع نکاح معتبر است و جایی برای استناد به مواد ۱۲۹۰ و ۱۲۹۱ ق.م وجود ندارد (ماده ۷۰ ق.ث که آنچه را مأمور رسمی احراز کرده است در برابر همه معتبر شمرده است). ولی، در مورد اثر معاملات و تعهداتی که در سند آمده است، باید اعتبار آن را محدود به دو طرفی که معامله کرده‌اند یا متعهد و قائم مقام آنان شمرد و به اشخاص ثالث سرایت ندارد. چنانکه، ماده ۷۱ ق.ث پس از اعلام رسمیت تمام محتویات و امضاهای سند رسمی، ماده ۷۰ ق.ث نسبی بودن اعتبار محتوای سند را از جهت آثار عمل حقوقی اینگونه بیان می‌دارد: «اسناد ثبت شده در قسمت راجعه به معاملات و تعهدات مندرجه در آنها نسبت به طرفین و یا طرفی که تعهد کرده و کلیه اشخاصی که قائم مقام قانونی آنها محسوب می‌شوند رسمیت و اعتبار خواهند داشت». حکم این ماده، تکرار و مبین اجمال ماده ۱۲۹۰ ق.م است و به همانگونه در مقام بیان اصل نسبی بودن مفاد اسناد و معاملات مندرج در آن است. تا زمانی که حکم ویژه‌ای آثار اصل نسبی بودن اعتبار معاملات مندرج در سند را به شخص ثالث سرایت ندهد قابل احترام است؛ چنانکه ماده ۷۲ ق.ث اعلام می‌کند: «کلیه معاملات راجعه به اموال غیر منقوله که بر طبق مقررات راجعه به ثبت املاک ثبت شده است نسبت به طرفین معامله و قائم مقام قانونی آنها و اشخاص ثالث دارای اعتبار کامل و رسمیت خواهد بود». این اعتبار استثنایی، به دلیل اعتبار نوعی دفتر املاک نسبت به همگان است و دولت کسی را مالک می‌شناسد که ملک در دفتر املاک به نام او ثبت شده است. (ماده ۲۲ ق.ث).

- کاتوزیان، ناصر، همان، ص ۲۸۴ و ۲۸۵.

موضوعات: بدون موضوع  لینک ثابت
 [ 07:08:00 ق.ظ ]
1 3