کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل


اسفند 1402
شن یک دو سه چهار پنج جم
 << <   > >>
      1 2 3 4
5 6 7 8 9 10 11
12 13 14 15 16 17 18
19 20 21 22 23 24 25
26 27 28 29      


کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

لطفا صفحه را ببندید

کلیه مطالب این سایت فاقد اعتبار و از رده خارج است. تعطیل کامل

https://andreeauk55432.blognody.com/25194163/هویت-برند https://remingtoncxnd10976.blogsumer.com/25286844/هویت-برند https://archermicu98766.jts-blog.com/25190152/هویت-برند https://lukasmnhy01087.rimmablog.com/25269779/هویت-برند https://kyleryzwq77766.bloggazza.com/25187394/هویت-برند https://zionqrpl55555.blogaritma.com/25285297/هویت-برند https://gunnerkelm61647.shoutmyblog.com/25269234/هویت-برند https://sergiofzzv60304.bcbloggers.com/25263610/هویت-برند https://cesarmgaf21468.blogcudinti.com/25336469/هویت-برند https://eduardokhll26492.iyublog.com/25272589/هویت-برند https://augustrrww34557.blogdiloz.com/25189351/هویت-برند https://claytonddzu99999.verybigblog.com/25283476/هویت-برند https://erickuwbw47016.activosblog.com/25163165/هویت-برند https://caidencztj93826.p2blogs.com/25193273/هویت-برند https://trentonihdy11000.bloggactivo.com/25287181/هویت-برند https://angeloljdw09998.theblogfairy.com/25280305/هویت-برند https://emiliovfjk55086.vidublog.com/25181670/هویت-برند https://josuetitk65510.oblogation.com/25289167/هویت-برند https://hectoreebw01111.gynoblog.com/25265988/هویت-برند https://holdenzcun37271.laowaiblog.com/25170228/هویت-برند https://erickneuc87778.angelinsblog.com/25267423/هویت-برند https://trentonmdti32087.bloggadores.com/25275804/هویت-برند https://andrefvmb09865.humor-blog.com/25165607/هویت-برند https://griffincgni47538.thekatyblog.com/25126347/هویت-برند https://mariokxgv86175.blogspothub.com/25253554/هویت-برند https://finneatk54322.idblogmaker.com/25257710/هویت-برند https://judahhctj32198.blogdemls.com/25251274/هویت-برند https://jaidengcul44311.ageeksblog.com/25164939/هویت-برند https://alexisuqiy09876.blogunteer.com/25187952/هویت-برند https://augusthooj48715.life3dblog.com/25165771/هویت-برند https://emilianokgxo65432.therainblog.com/25160392/هویت-برند https://sethtccc95204.ltfblog.com/25174927/هویت-برند https://josueluvr25755.blogmazing.com/25260883/هویت-برند https://jeffreytofv87532.blogars.com/25157959/هویت-برند https://tysonfzri32109.thechapblog.com/25257489/هویت-برند https://dallasnjbv98754.blogsvirals.com/25260132/هویت-برند https://troyhxnb09865.glifeblog.com/25191182/هویت-برند https://lukasjllg55554.losblogos.com/25255850/هویت-برند https://arthurwrhw80345.estate-blog.com/25271952/هویت-برند https://beautlbq65320.prublogger.com/25267931/هویت-برند https://griffinnjcs87653.blogdomago.com/25160852/هویت-برند https://codyfzri32209.bloguerosa.com/25185675/هویت-برند https://tysontles25925.daneblogger.com/25262149/هویت-برند https://deanlepw36780.goabroadblog.com/25237513/هویت-برند https://garrettljex00999.popup-blog.com/25260628/هویت-برند https://milotkap65321.blogozz.com/25264611/هویت-برند https://brooksmlnn25110.activablog.com/25281777/هویت-برند https://fernandosohx09876.bloggazzo.com/25227053/هویت-برند https://troyzupo26048.ssnblog.com/25250719/هویت-برند https://simonhcul44321.activoblog.com/25597922/هویت-برند https://deankduj32198.blogoxo.com/25589725/هویت-برند https://landenwswt57184.elbloglibre.com/25453150/هویت-برند https://cashqbgh18284.blog-ezine.com/25562979/هویت-برند https://franciscolkct49440.blogscribble.com/25546372/هویت-برند https://garrettlfxn53209.madmouseblog.com/5946228/هویت-برند https://troyroiy62839.ja-blog.com/25513461/هویت-برند https://shaneqldu87654.blogtov.com/5942686/هویت-برند https://louisslds76431.digitollblog.com/25352183/هویت-برند https://cesarbvmb19875.blazingblog.com/25546464/هویت-برند https://connerzqgv86532.creacionblog.com/25409753/هویت-برند https://elliottpzed20861.tusblogos.com/25485994/هویت-برند https://landenggdz11111.blogchaat.com/25507247/هویت-برند https://shanebujv47135.dm-blog.com/25551786/هویت-برند https://spencerhxoc19876.smblogsites.com/25477649/هویت-برند


جستجو


آخرین مطالب


 



اهمیت اصل حسن­نیت در رابطه با بیمه­‏گذار در عمل بیمه­‏گری در کشورهای مترقی سیر نزولی‏ دارد، زیرا با پیشرفت علم آمار و استفاده از آن و از طرف دیگر با هماهنگ شدن قوانین‏ و مقررات و گسترش شیوه ­های نظارت در امر بیمه، تعداد زیاد از عوامل‏ اختصاصی موضوعات بیمه‏ای در گروه اطلاعات عمومی‏ در ‏آمده­اند. ولی‏ برعکس اطلاعات‏ بیشتری باید در اختیار بیمه‏گذار قرار گیرد.[۸۰]

ب- اصل حسن­نیت در رابطه با بیمه­گر

یکی از حقوق مسلم بیمه­گذار آن است که اقدام وی به انعقاد قرارداد با اطلاع کامل از شرایط بیمه باشد، به نحوی که مطمئن باشد آنچه به عنوان حق­بیمه می ­پردازد، دارای معوض مورد نظر او ‌می‌باشد. بیمه­گر موظف است در بیمه­نامه هر آنچه که نشان دهنده تعهدات اوست، چه از لحاظ کیفی و چه از لحاظ کمی، به وضوح ذکر کند و مواردی‏ را که به نحوی از انحا در صورت بروز حادثه می ­تواند مؤثر در پرداخت خسارت باشد، در بیمه­نامه قید نماید، به طوری که تعهدات بیمه‏گر از ‌هر جهت برای‏ بیمه‏گذار مشخص باشد. ‌بنابرین‏ رعایت اصل حسن نیت تنها محدود به بیمه‌گذار نیست.[۸۱]

برخی موارد پاسخ منفی بیمه­گر به بیمه­گذار برای جبران خسارت مستند به ایرادات موجود در بیمه­نامه است و اگرچه بیمه­گر قرارداد بیمه را راسا یا از طریق نمایندگان خود آن را صادر نموده است، لیکن درهنگام بررسی خسارت اعلام می­ نماید که بیمه­نامه منطبق با شرایط و وضعیت بیمه­گذار تهیه نشده است. اگرچه بیمه­گذار را ‌می‌توان به عدم تحقیق از اصول بیمه متهم نمود، لیکن نمی­ توان قبول کرد که بیمه­گر نیز از این شرایط بی­اطلاع بوده و سهوا اقدام به صدور بیمه نامه­ های ناقص و یا نامناسب می­ نماید. گاه بیمه­گر با این عمل خود به جهل بیمه­گذار دامن زده ویا حتی از این ناآگاهی بیمه­گذار سوءاستفاده می­ نماید،. چنین رفتاری مغایر با اصل حسن­نیت ‌می‌باشد.[۸۲]

گفتار دوم : شروط قراردادی

معمول است که در عقد بیمه هر یک از طرفین به موجب شرایط قرارداد بر عهده می­ گیرند که کلیه عوامل مؤثر در نرخ بیمه و شرایط انعقاد را که برای طرف مقابل ناشناخته است، افشا نماید، و بنابر همین ابتنای قراردادی است که وظیفه ارائه اطلاعات تحمیل می­گردد.[۸۳]

اثر اصلی قراردادی تلقی نمودن وظیفه ارائه اطلاعات در تعیین بار اثبات است. در مسئولیت قراردادی صرف خودداری متعهد از انجام تعهد، تقصیر محسوب می­ شود. ‌بنابرین‏ طرف متعهد به ارائه اطلاعات می­بایست بی­تقصیری خود را اثبات نماید و متعهد­له جهت دعوای مطالبه خسارت کافی است که رابطه سببیت بین خودداری از ارائه اطلاعات و ورود ضرر را ثابت نماید. ‌بنابرین‏ اگر تعهد به ارائه اطلاعات را دارای ریشه قراردادی تلقی نماییم، صرف احراز نقص اطلاعات و یا عدم ارائه پاره­ای از اطلاعات، کافی جهت تحقق مسئولیت قراردادی است.[۸۴]

از نقطه نظر حقوق تطبیقی ذکر این نکته مفید خواهد بود که در حقوق فرانسه به لحاظ سیر تاریخی، مقوله شروط به عنوان یکی از مبانی وظیفه ارائه اطلاعات تلقی می­ شود، در حالی که در حقوق انگلستان دیدگاه غالب آن است که وظیفه ارائه اطلاعات در عقد بیمه توسط قانون تحمیل می­ شود.[۸۵]

گفتار سوم : عرف و اقتضای اوضاع احوال

عرف و عادات مسلم جامعه در پیدایش حقوق و تعهدات نقش بسزایی ایفا می­ کند. عرف هر جامعه به صورت مجموعه‏ای از قواعد و مقررات متجلی می‏ شود که گذشت زمان و اعتقاد به الزام‏آور بودن، چنان حالتی بدان بخشیده که هر گونه تخطی از حدود آن عکس العمل عمومی را به دنبال خواهد داشت. عرف و عادت به مانند زیربنایی است که حقوق به ویژه مقررات مربوط به عقود و قراردادها بر اساس آن شکل گرفته است.[۸۶]

عرف در کنار قانون، رویه قضایی و دکترین جزء منابع حقوق به شمار می ‏آید. اهمیت عرف در علم حقوق‏ ‌بر کسی پوشیده نیست. در قوانین موضوعه نیز بر اهمیت این موضوع تأکید شده است. عرف هم به عبارتی مکمل قانون است و هم‏ نقشی در آرای قضایی دارد و قضات دادگاه‏ها در انشای احکام قضایی گاها به عرف و رویه معمول آن قضیه استناد می‏ کنند.[۸۷]

در قانون مدنی و در بحث عقود نیز نقش عرف بسیار حایز اهمیت است و در مواردی به‏ آن اشاره شده است، از جمله در ماده ۲۲۴ آمده است «الفاظ عقود محمول است بر معانی عرفیه»، و در ماده ۲۲۵ نیز قانون‏گذار اشاره دارد که «متعارف بودن امری در عرف و عادت به طوری که عقد بدون‏ تصریح هم منصرف به آن باشد به منزله ذکر در عقد است.»

ماده ۲۲۰ قانون مدنی مقرر می­دارد «عقود نه فقط متعاملین را نسبت به چیزی که در آن تصریح شده بلکه به کلیه نتایجی که به موجب عرف و عادت یا به موجب قانون از عقد حاصل می شود ملزم می­ کند.»

از آنجا که بیمه یک قرارداد است، لذا عرف نقش مهمی را در تبیین و تفسیر شرایط و تعهدات آن دارا است. از آنجا که از جمله مقتضیات عرفی عقد بیمه ارائه اطلاعات توسط طرفین ‌می‌باشد، ‌می‌توان ادعا کرد نقش عرف به لحاظ تصریح به لزوم ارائه اطلاعات بسیار حائز اهمیت است. همچنین عرف می ­تواند نقش اساسی در تحدید قلمرو و تعیین مصادیق تعهدات اطلاعاتی ایفا نماید.

گفتار چهارم : قانون

به موجب نظر مشهور قانون مهمترین مبنای تحمیل­کننده تکلیف ارائه اطلاعات در قرارداد بیمه به شمار می ­آید. در این خصوص قانون­گذار حسب اوضاع احوالی که در حین قرارداد یا متعاقب آن ممکن است رخ دهد، آثار متفاوتی را بر این تکلیف بار کرده­ است. در قانون بیمه ۱۳۱۶ که در حال حاضر قانون اصلی در زمینه قراردادهای بیمه به شمار می ­آید، در مواد متعدد به وظیفه ارائه اطلاعات اشاره شده است.[۸۸]

با توجه ‌به این مواد در خصوص تعهد بیمه­گذار به ارائه اطلاعات بدون شک باید مبنای آن را الزام قانون دانست. حتی درج شرط ارائه اطلاعات در متن بیمه­نامه­ ها و گرفتن تعهد به افشای تمام حقایق در فرم تقاضای بیمه، نمی­تواند نقش قانون در این مورد را کمرنگ نماید. اما در خصوص بیمه­گر در قانون هیچ اشاره­ای نشده است. بحث تعهدات اطلاعاتی بیمه­گر در عقد بیمه را بر اساس دو ضرورت ‌می‌توان توجیه نمود. یکی ضرورت عام و کلی که در هر عقدی که بین طرف متخصص با غیرمتخصص منعقد می­ شود مورد بررسی قرار ‌می‌گیرد و دیگری ویژگی­های معین عقد بیمه که به طور خاص ضرورت ارائه چنین اطلاعاتی را توجیه­پذیر می­ نماید.[۸۹]

اظهار نظر شده است که ‹‹علاوه بر مواد متعددی که به وظیفه بیمه­گذار به ارائه پاره­ای اطلاعات تصریح دارد، لزوم ارائه اطلاعات اساسی توسط طرفین عقد بیمه، از روح قانون بیمه و ذات عقد بیمه که عقدی مبتنی بر حسن­نیت است، قابل استنباط ‌می‌باشد.››[۹۰]

‌بنابرین‏ در نهایت چنین به نظر می­رسد که باید میان مبنای تعهدات اطلاعاتی بیمه­گذار با بیمه­گر قائل به تفکیک شد. علت الزام بیمه­گذار حکم قانون است، در حالی که علت الزام بیمه­گر حکم عرف و اقتضای اوضاع احوال ‌می‌باشد.

مبحث سوم : قلمروی تعهدات اطلاعاتی در قرارداد بیمه

موضوعات: بدون موضوع  لینک ثابت
[چهارشنبه 1401-09-30] [ 10:32:00 ق.ظ ]




این تعریف، تعریف مالکیت فردی است که هر یک از افراد جامعه می تواندآن را دارا باشد .در مقابل اموالی

که موضوع مالکیت فردی قرار می‌گیرد ،اموالی هستند که مالک خاص ندارد.[۶۳]

ب ـ تقسیم بندی انواع اراضی

اراضی را از چند منظر می توان تقسیم بندی کرد که عبارتند از:

الف – موقعیت و محل استقرار

این اراضی به دو نوع تقسیم می شود:

۱ـ اراضی شهری یا اراضی واقع در محدوده شهر: برابر ماده ۲ قانون زمین شهری مصوب ۲۲/۶/۱۳۶۶ «اراضی شهری زمین هایی است که در محدوده قانونی و حریم استحفاظی شهرها و شهرکها قرار گرفته است…».

۲- اراضی غیر شهری یا اراضی خارج از محدوده شهری : اراضی که خارج از محدوده شهر و شهرک واقع است.

ب ـ از نظر بهره برداری

شامل اراضی بابر، دایر ، موات ، اراضی ملی و جنگلها می شود که متعاقباً تشریح خواهد گردید .

اراضی جمع ارض میئ باشد که در فارسی ‌به این زمین گفته می شود .در اصطلاحات ذیل به کار رفته است . هم چنین از جهاتی دیگر نیز اراضی تقسیم بندی می شود که در فقه و منابع اسلامی بیان شده است[۶۴]

ج ـ انواع اراضی از دیدگاه اسلام

۱)زمین بایر از اصل یا موات بالاصاله

۲)زمین بایر عارضی یا موات بالعارض

۳)زمین آباد از اصل یا محیاء بالاصاله (در حکم زمین موات بوده و در قوانین ، جزء انفال می‌باشد)

۴)زمین آباد عارضی یا محیاه بالعارض[۶۵]

۵)ملک خصوصی که ممکن است یک یا چند نفر مالک داشته باشد. به طور کلی انواع اراضی را می توان به شرح زیر تقسیم بندی نمود:

اراضی موات، بایر ،دایر، ملی[۶۶]

که در زیر تعاریف آن ها را ذکر می‌کنیم.

۱ـ اموال دولتی وعمومی

دولت برای انجام خدمت عمومی و اجرای وظایف خود ، اموال گوناگونی در اختیار دارد و به تناسب موارد از هر یک استفاده خاصی می‌کند. اموال دولتی[۶۷]به معنای عام را می توان به دو دسته تقسیم کرد:[۶۸]

۱)اموال عمومی ـ این اموال بر دو قسم است :

الف :اموالی که مستقیماً در اختیار عموم برای بهره برداری قرار داده می شود مانند پل ها، خطوط راه آهن

،موزه ،کتابخانه‌های عمومی و پارکها[۶۹]

مشترکات عمومی چنان که از نام آن معلوم می شود اموالی است که متعلق به عموم می‌باشد و طبق ماده ۲۳ قانون مدنی استفاده از آن ها برای افراد مطابق قوانین مربوط به آن خواهد بود .هیچ یک از افراد نمی تواند در این گونه اموال تصرفی نمایند که دیگران از استفاده از آن محروم گردند. به عبارت دیکر تملک این اموال به وسیله افراد در مواد ۲۴و۲۵ قانون مدنی صریحاً منع گردیده است . ماده ۲۴ قانون مدنی مقرر می‌دارد : «هیچ کس نمی تواند طرق و شوارع عامه و کوچه هایی که آخر آن ها مسدود نیست تملک کند».ولی کوچه هایی که آخر آن ها مسدود است هرگاه ملک افراد باشد آن ها می‌توانند در آن هر گونه تصرفی بنمایند ، به عنوان مثال هرگاه کوچه بن بستی متعلق به یکی از خانه های مجاور است و خانه های دیگر در آن حق عبور دارند ، مالک کوچه می‌تواند با توافق دیگران آن را جزء خانه خود بنماید .و هرگاه کسی حقی در آن کوچه نداشته باشد مالک می‌تواند هر گونه تصرفی که بخواهد در آن بکند و موافقت دیگران لازم نیست . و هرگاه کوچه بن بست نباشد مانند کوچه هایی است که آخر آن ها مسدود نیست و از مشترکات عمومی است. [۷۰]

ب :اموالی که اختصاص به یک خدمت عمومی داده شده است مانند بیمارستان عمومی و اشیا ء مورد نیاز این بیمارستان .

۲)اموال اختصاصی دولت و هر شخص حقوقی حقوق عمومی که در آن اموال مانند اشخاص خصوصی عمل می‌کنند .اموال شخص اداری اگر متعلق به دولت باشد اموال دولتی نامیده می شود (ماده ۲۶ قانون مدنی) مانند مزارع نمونه دولتی و یا قنات شهرداری که آب آن را برای مصرف باغات می فروشد.اینجا قواعد تملک خصوصی حکومت می‌کند.[۷۱] و تقاضای ثبت املاک دولتی و املاکی که به موجب قوانین خاص در مالکیت دولت قرار می‌گیرد از طرف سازمان‌های مربوطه به عمل می‌آید.[۷۲]مراد از سازمان‌های مربوطه اداره دارایی و شهرداری محل می‌باشد که مکلف به درخواست ثبت املاک متعلق به دولت و شهرداری می‌باشند.[۷۳]شهرداری هم مانند دولت دارای اموال عمومی و اختصاصی می‌باشد .‌بنابرین‏ نباید عبارت (اموال عمومی )را در کنار (اموال دولتی ) نهاد که موجب اشتباه خواننده گردد. ماده ۲۶ قانون مدنی نیز گواه این مطب است که شهرداری همانند دولت دارای اموال عمومی می‌باشد.

اثر بارز خصوصی این اشخاص ، قابلیت نقل و انتقال است ‌بنابرین‏ اموال عمومی شخص اداری قابل نقل و انتقال نیست مگر اینکه نص خاص قانون آن را از قلمرو خود خارج کرده و در قلمرو اموال اختصاصی شخص اداری قراردهد. مانند ماده ۱۹ قانون نوسازی و عمران شهری مصوب ۷/۹/۱۳۴۷ که مقرر می‌دارد: «هرگاه در نتیجه طرح هادی شهر داری تمام یا قسمتی از معابر به صورت متروک در آید آن قسمت متعلق به شهرداری خواهد بود و هرگاه شهرداری قصد فروش آن را داشته باشد مالک مجاور در خرید آن حق تقدم خواهد داشت».[۷۴]

الف ـ ضابطه تشخیص اموال دولتی وعمومی

طرز تشخیص اموال و مشترکات عمومی و تمییز آن ها از سایر اموال دولتی ، از مباحث مهم حقوق اداری است ولی ، چون در حقوق مدنی نیز این گونه اموال به لحاظ حق اشخاص مورد گفتگو است اجمالاً آن را بیان می‌کنیم .

پاره ای از نویسندگان ، اموالی را در شمار مشترکات عمومی آورده اند که طبیعت آن ها اقتضا دارد که ، به ملکیت خصوصی در نیاید و مورد استفاده عموم مردم قرارگیرد : مانند ساحل دریا و رودخانه های قابل کشتیرانی .عده ای دیگر معیار را مصرفی قرارداده اند که دولت برای این قبیل اموال معین ‌کرده‌است .آن ها می‌گویند باید دید اموال دولتی به چه منظور مورد بهره برداری قرار می‌گیرد و به تناسب این منظور نوع مال را تشخیص داد.

برای توجیه نظر اخیر که مورد تأیید بسیاری از نظریه پردازان بزرگ حقوق عمومی ،واقع شده است باید گفت اموال عمومی به دو صورت مورد استفاده قرار می‌گیرد:

الف : پاره ای از آن ها به طور مستقیم و بی واسطه در دسترس عموم قرار گرفته است و هر کس با رعایت نظامات مخصوص می‌تواند استفاده مطلوب را بکند .مانند پل ها ، باغها و راه های عمومی.

ب : دسته دیگر به یکی از خدمات عمومی اختصاص یافته است و تنها بنگاه خاصی حق بهره برداری از آن را دارد. مانند راه آهن، سیمهای تلفن وتلگراف.

پس تمام اموالی که که به طور مستقیم یا با واسطه از طرف دولت برای رفع نیازمندی‌های عمومی اختصاص یافته است از اموال عمومی است و سایر اموال دولتی ملک دولت محسوب می شود از مفاد مواد ۲۴تا ۲۷ قانون مدنی نیز چنین بر می‌آید که از همین قاعده پیروی شده است .[۷۵]

ب ـ فایده تشخیص اموال دولتی و عمومی

قانون مدنی به تفصیل تفاوت احکام مربوط به اموال عمومی و دولتی را بیان نکرده فقط دسته نخست را قابل تملک خصوصی ندانسته است .در حقوق عمومی ما نیز هنوز رویه خاصی ایجاد نشده است ؛ولی از قابل تملک نبودن اموال عمومی ممکن است این نتایج استنباط شود :

موضوعات: بدون موضوع  لینک ثابت
 [ 10:02:00 ق.ظ ]




۳-۹-۷- ضریب همبستگی پیرسون
ضریب همبستگی یکی از معیارهای مورد استفاده در تعیین همبستگی دو متغیر میباشد و شدت رابطه و همچنین نوع رابطه (مستقیم یا معکوس) را نشان میدهد. این ضریب بین ۱ تا ۱- است و در صورت عدم وجود رابطه بین دو متغیر برابر صفر میباشد. ضریب همبستگی پیرسون، روشی پارامتری است و برای دادههایی با توزیع نرمال و یا تعداد داده های زیاد استفاده میشود. این ضریب از رابطه زیر محاسبه میشود (دانشگر، ۱۳۹۰)
آدرس سایت برای متن کامل پایان نامه ها
۳-۱۰- متغیرهای پژوهش
متغیر به عنوان یکی از عناصر اصلی پژوهش، به شکلهای مختلف و معیارهای متفاوت دستهبندی میشود. در این پژوهش بکارگیری فناوری اطلاعات به عنوان متغیر مستقل و هزینه های کیفیت به عنوان متغیر وابسته در نظر گرفته شده است.
۳-۱۱- قلمرو پژوهش (موضوعی، مکانی، زمانی)
قلمرو موضوعی
در این پژوهش به بررسی نقش و تاثیر بکارگیری فناوری اطلاعات بر هزینه های کیفیت پرداخته میشود. و به این مقوله میپردازیم که بکارگیری و کاربرد فناوری اطلاعات تا چه حد توانسته بر هزینه های کیفیت تاثیرگذار باشد. و همچنین هر یک از هزینه های کیفیت از دیدگاه رئیسان و معاونان شعب بانک مسکن شهر تهران در چه سطحی قرار دارد.
قلمرو مکانی
قلمرو مکانی پژوهش، شعب بانک مسکن موجود در شهر تهران میباشد.
قلمرو زمانی
مطالعات مقدماتی این پژوهش از اردیبهشت ماه ۱۳۹۳ آغاز گردید و این پژوهش در دی ماه همان سال پایان یافت.
فصل چهارم:
تحلیل داده ها
۴-۱- مقدمه
تجزیه و تحلیل داده ها فرآیندی چند مرحلهای است که طی آن دادههایی که از طریق بکارگیری ابزارهای جمعآوری در نمونه (جامعه) آماری فراهم آمدهاند و خلاصه، کدبندی، دستهبندی و… شدهاند، در نهایت پردازش میشوند تا زمینه برقراری انواع تحلیلها و ارتباطها بین این داده ها به منظور آزمون فرضیه ها فراهم آید. در این فرآیندها، داده ها هم از لحاظ مفهومی و هم از جنبه تجربی پالایش میشوند و تکنیکهای گوناگون آماری نقش بسزایی در استنباطها و تعمیمهای بعدی دارند (خاکی، ۱۳۸۷: ۳۲۵).
تجزیه و تحلیل اطلاعات به عنوان مرحلهای علمی از پایه های اساسی هر پژوهش علمی به شمار میرود که به وسیله آن کلیه فعالیتهای پژوهش تا رسیدن به نتیجه، کنترل و هدایت میشوند.
در این فصل نیز به توصیف داده های پژوهشی و تحلیل دادههایی که به وسیله پرسشنامه از افراد نمونه گردآوری شده‌اند پرداخته خواهد شد و سپس به هر یک از فرضیات پاسخ داده می‌شود.
۴-۲- توصیف ویژگیهای جمعیت شناختی اعضای نمونه
به منظور شناخت بهتر ماهیت جامعهای که در پژوهش مورد مطالعه قرار گرفته است و آشنایی بیشتر با متغیرهای پژوهش، قبل از تحلیل داده های آماری، لازم است این داده ها توصیف شود.
همچنین توصیف آماری داده ها، گامی در جهت تشخیص الگوی حاکم بر آنها و پایهای برای تبیین روابط بین متغیرهایی است که در پژوهش بکار میرود. بنابراین در این فصل ابتدا به توصیف آماری داده ها پرداخته میشود:
۴-۲-۱- جنسیت
جدول ۴-۱- توزیع فراوانی مربوط به جنسیت

جنسیت فراوانی درصد فراوانی
مرد ۱۷۸ ۶/۸۸
زن ۲۳ ۴/۱۱
جمع
موضوعات: بدون موضوع  لینک ثابت
[شنبه 1400-03-22] [ 02:53:00 ب.ظ ]




slVTG5’RACE-R3

 

 

معکوس

 

 

TTCCAACCACACCATTAGCA

 

 

۳۶۶ a

 

 

 

slβactin5’RACE-R1

 

 

معکوس

 

 

GGCACCTGAACCTCTCATTG

 

 

۸۶۷ b

 

 

 

slβactin5’RACE-R2

 

 

معکوس

 

 

GAGCTTCTCCTTGATGTCACG

 

 

۷۴۳ b

 

 

 

QPCR

 

 

slQVTG-F3

 

 

مستقیم

 

 

GAATGCACAAAGAGGGTCAAG

 

 

۶۳۰ a

 

 

 

slQVTG-R3

 

 

معکوس

 

 

TTGAAGGGTGAAAACTGATGC

 

 

۷۵۷ a

 

 

 

slQβactin-F3

 

 

مستقیم

 

 

CCTGTTCCAGCCATCCTTCT

 

 

۸۷۵ b

 

 

 

slQβactin-R3

 

 

معکوس

 

 

TGGTACCACCAGACAATACGG

 

 

۱۰۰۵ b

 

 

a موقعیت نسبت بهcDNA کامل ویتلوژنین درP. esfahani.
b موقعیت نسبت به cDNA کامل بتا-اکتین درP. esfahani.
۳-۹- مقایسات آماری
داده های آماری به صورت میانگین ± خطای استاندارد گزارش شدند. کلیه محاسبات آماری با بهره گرفتن از دو نرم افزار SPSS 19 و Microsoft Office Excel 2010 انجام شد. پس از اطمینان از توزیع نرمال داده ها و یکنواختی واریانس ها[۱۱۸] از آزمون تجزیه واریانس یک­طرفه[۱۱۹] برای مقایسه واریانس شاخص ­های موردنظر در هر ایستگاه و از آزمون چند دامنه دانکن[۱۲۰] در سطح ۰۵/۰ برای بررسی وجود یا عدم وجود اختلاف معنی­دار بین ایستگاه­ها استفاده شد. همچنین در هر ایستگاه برای مشخص کردن وجود یا عدم وجود انحراف نسبت جنسی از نسبت مورد انتظار، از آزمون مربع کای[۱۲۱] استفاده شد.
فصل چهارم
نتایج و بحث
۴-۱- شاخص ­های زیستی ماهیان صید شده
در این مطالعه در مجموع تعداد ۳۲۳ قطعه ماهی صید شد. از این تعداد، ۱۰۴ قطعه متعلق به ایستگاه چشمه­دیمه، ۸۱ قطعه متعلق به ایستگاه خرسونک، ۶۳ قطعه متعلق به ایستگاه چمگردان و ۷۵ عدد متعلق به ایستگاه پل صفائیه بود. دامنه سنی ماهیان در ایستگاه­ چشمه­دیمه ۱-۵ سال و در سه ایستگاه خرسونک، پل صفائیه و چمگردان ۳-۵ سال بود. تعداد ماهیان صید شده از هر ایستگاه به تفکیک جنسیت در جدول ۴-۱ مشاهده می­ شود.

در ماهیان صید شده از ایستگاه چشمه­دیمه، خرسونک، پل صفائیه و چمگردان میانگین وزنی به ترتیب ۳۱/۱ ± ۱۳/۱۸، ۳۴/۱ ± ۸۵/۲۵، ۱۳/۱ ± ۸۷/۴ و ۵۰/۰ ± ۷۶/۱۰ گرم و میانگین طولی به ترتیب ۳ ± ۱۰۷، ۲ ± ۱۱۸، ۴ ± ۶۹ و ۱ ± ۹۱ میلی­متر محاسبه شد (جدول ۴-۱). همان­طور که مشاهده می­ شود، اختلاف طول و وزن ماهیان در بین تمام ایستگاه­ها معنی­دار است (۰۵/۰p<). بیش­ترین و کم­ترین میزان میانگین طول و وزن ماهیان به ترتیب در ایستگاه­های خرسونک و چمگردان مشاهده شد.
جدول ۴-۱) ویژگی­های زیستی ماهیان صید شده در ایستگاه­های نمونه­برداری رودخانه زاینده­رود.

 

 
موضوعات: بدون موضوع  لینک ثابت
 [ 02:52:00 ب.ظ ]




بهمنی، نقیائی، علیمحمدی و دهخدا (۱۳۹۲) در مطالعهای باهدف بررسی نشانگان افت روحیه در زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و مقایسه آن با جمعیت عادی به این نتیجه رسیدند که تفاوت معناداری بین میانگین نشانگان افت روحیه زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) و زنان سالم وجود دارد و میانگین نشانگان افت روحیه زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) (۲۲/۳۷) با توجه به نمره برش (۳۰<) میزان بالایی را به خود اختصاص داد.

بهمنی، نقیائی، علیمحمدی و دهخدا (۱۳۹۲) در مطالعهای با عنوان بررسی رابطه سه متغیر اضطراب وجودی، نشانگان افت روحیه و افسردگی در مادران کودکان مبتلا به بیماریهای بالقوه مهلک به این نتیجه رسیدند که بین سه متغیر رابطه معناداری وجود دارد، به طوری که اضطراب وجودی بالا پیش‌بینی کننده نشانگان افت روحیه بوده و درعین‌حال نشانگان افت روحیه بالا پیش‌بینی کننده افسردگی است.
تصویر مرتبط با افسردگی در روانشناسی Psychological depression
رحیمی و همکاران (۱۳۹۳) در مطالعهای تحت عنوان «اثربخشی مشاورهی شناختی معنویتمحور بر کاهش نشانگان افت روحیه سالمندان» به این نتیجه رسیده اند که رویکرد مشاورهی شناختی معنویتمحور میتواند در کاهش نشانگان افت روحیه سالمندان و حتی هر مشکل روحی و روانی دیگری که ریشه های وجودی، معنوی و شناختی دارد، موثر واقع شود.
مطالعات روان‌درمانی‌های انجام‌شده بر روی HIV:
روائی، حسینیان و صمدی (۱۳۸۵) به منظور بررسی تأثیر روان‌درمانی حمایتی بر بهبود کیفیت زندگی بیماران به این نتیجه رسیدند که رواندرمانی حمایتی بر بهبود کیفیت زندگی افراد مبتلا با توجه به عوامل کلی سلامت جسمانی و روانی تأثیر دارد.

سلگی، هاشمیان و سعیدی (۱۳۸۶) در مطالعه خود به بررسی تأثیر شناخت درمانی گروهی در کاهش افسردگی مردان مبتلا به HIV مثبت پرداختند نتایج آن‌ ها نشان داده بود که گروه درمانی شناختی میتواند یک روش موثری در کاهش افسردگی و افزایش کیفیت زندگی آن‌ ها باشد.
همچنین قزلسفلو و اثباتی (۱۳۹۰) در تحقیقی نشان دادند که گروه درمانی امید محور باعث بهبود کیفیت زندگی مردان مبتلا شده بود. حال با توجه به بیماری HIV و تبعاتی که برای بیمار به همراه دارد و کمبود پژوهشهای حاضر در مورد اثربخشی درمان روان‌شناختی بر افراد مبتلا به HIV مثبت پژوهشگر به دنبال آن برآمد تا با درمان روانشناختی موثر (شناخت درمانی هستینگر) بتواند به کاهش تبعات روانی –اجتماعی ذکرشده در زندگی بیماران بپردازد.
 تصویر درباره جامعه شناسی و علوم اجتماعی
رحمتی نجار کلائی و همکاران (۱۳۹۱) در مطالعهای تحت عنوان تجربیات بیماران مبتلا به ایدز از ننگ اجتماعی: یک مطالعه کیفی بیان کردند که اکثر بیماران بر مسئله فقدان درمان قطعی بیماری و ناامیدی به زندگی تأکید مینمودند و عاقبت خود را مرگ و نیستی میدانستند؛ به طوری که این ناامیدی روی کیفیت زندگی این افراد تأثیر نامطلوبی داشته و انتظار مرگ را در ذهن آن‌ ها مدام به تصویر میکشید همچنین بیماران این ناامیدی را از اثرات مهم این بیماری بر روی روحیه خود بیان کرده‌اند.
علیزاده و بهرامی (۱۳۹۱) در مطالعهای تحت عنوان بررسی تأثیر برنامه رفتاردرمانی عقلانی-هیجانی بر تاب آوری و سلامت روان زنان مبتلا به اچ.آی.وی/ایدز دارای سابقه سوء مصرف مواد و رفتارهای پرخطر جنسی به این نتیجه دست یافتند که آموزش مفاهیم رویکرد رفتاردرمانی عقلانی-هیجانی می‌تواند بر افزایش سطح تاب آوری و کاهش اضطراب و افسردگی زنان مبتلا به اچ.آی.وی/ایدز دارای سابقه سوء مصرف مواد و رفتارهای پرخطر جنسی موثر باشد.
در ایران پژوهش‌های متعددی در زمینه‌ی شناخت درمانی هستینگر صورت گرفته است که شامل:
بهمنی، اعتمادی, شفیع آبادی، دلاور و قنبری مطلق (١٣٨٩) در مطالعهای با عنوان مقایسه اثربخشی دو روش مداخله «شناختدرمانی آموزش محور به سبک مایکل فری» و «گروه درمانی شناختی/وجودگرا» بر امیدواری، عزت نفس و کیفیت زندگی زنانی که پس از شروع درمان سرطان غیر منتشر سینه، علائم افسردگی از خود بروز دادهاند، نشان داده است که میانگین افسردگی بعد از مداخله در گروه درمانی شناختی وجودگرا کمتر از شناختدرمانی آموزش محور است و افسردگی هر دو گروه نیز پایینتر از گروه گواه بوده و تفاوتها از نظر آماری معنادار است. در متغیر امیدواری نیز تأثیر روش گروه درمانی شناختی وجودگرا بر افزایش امیدواری بیشتر از روش شناختدرمانی آموزش محور و این تفاوت از لحاظ آماری معنادار بوده و هر دو گروه نیز میانگین بیشتری نسبت به گروه کنترل به دست آورده‌اند. در متغیر عزت نفس میانگین‌های دو گروه آزمایش با یکدیگر برابر اما با میانگین گروه کنترل تفاوت معنادار دارد. مقادیر میانگین نشان میدهد که عزت نفس در هر دو گروه نسبت به گروه گواه افزایش داشته و این تفاوت از نظر آماری معنیدار است. میانگین کیفیت زندگی در دو نوع مداخله شناختدرمانی آموزش محور و گروه درمانی شناختی وجودگرا با یکدیگر تفاوت نداشته اما نسبت به گروه کنترل بیشتر بوده است. این تفاوتها نیز به لحاظ آماری معنی‌دار است.
بهمنی، اسکندری، حسنی، دکانهای فرد و شفیع آبادی (۱۳۹۰) در مطالعه‌ای تحت عنوان « اثربخشی گروه درمانی شناختی وجودگرا بر افزایش امیدواری و کاهش افسردگی والدینی که فرزندانشان به دلیل ابتلا به سرطان تحت درمان‌های پزشکی قرار دارند» به این نتیجه رسیده است که گروه درمانی شناختی وجودگرا می‌تواند در افزایش امیدواری والدین فرزندان مبتلا به سرطان موثر باشد.
بهمنی، کرمانی رنجبر، قنبری مطلق و اسکندری (۱۳۹۱) در مطا
لعهای تحت عنوان« اثربخشی مداخله گروه درمانی شناختی وجودگرا بر بهبود کیفیت زندگی زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است)» نشان داده است که این رویکرد باعث افزایش و بهبود کیفیت زندگی زنان مبتلا به سرطان PESTAN(به خاطر محدودیت سایت در درج بعضی کلمات ، این کلمه به صورت فینگیلیش درج شده ولی در فایل اصلی پایان نامه کلمه به صورت فارسی نوشته شده است) شده است.
بهمنی، معتمد (۱۳۹۱) در مطالعه‌ای تحت عنوان « اثربخشی گروه درمانی شناختی- هستی نگر بر افزایش امیدواری در زنان مبتلا به همودیالیز» به این نتیجه رسیده است که میانگین امیدواری در گروه زنانی که در معرض مداخله گروه درمانی شناختی هستی نگر قرار گرفته‌اند به نحو بازر و معنی‌داری از گروهی که (گروه کنترل) در معرض این مداخله قرار نگرفته‌اند، افزایش یافته است.
۲-۶-۲ تحقیقات انجام‌شده در خارج از کشور:
بر خلاف مطالعات داخلی، مطالعات خارجی حاکی از آن است که بر روی متغیر وابسته پژوهش یعنی «نشانگان افت روحیه» پژوهش‌هایی صورت گرفته است، اما هیچ پژوهشی بر روی جمعیت افراد مبتلا به HIV انجام نشده است.
سورجیت ساهو[۱۸۲] (۲۰۰۹) در مقاله‌ی مروری خود تحت عنوان «متغیرهای نشانگان افت روحیه» عنوان می‌کند علی‌رغم شباهت آزردگی وجودی و نشانگان افت روحیه، متغیر نشانگان افت روحیه با علائمی چون ناتوانی در پیشبرد زندگی همراه است. البته نشانگان افت روحیه در افراد مبتلا به افسردگی ممکن است بروز کند. همچنین حس ناامیدی که جزء علائم اصلی این متغیر است می‌تواند منجر به ضعف فیزیکی و روانی فرد شده و به خودکشی و آرزوی مرگ رو آورد.
جاکوبسن[۱۸۳] (۲۰۰۷) در مطالعهی موردی تحت عنوان «بررسی نشانگان افت روحیه در حوزه‌ی درمان» به این نتیجه رسید که ١٠ تا ٢۵ درصد بیماران سرطانی از افسردگی رنج می‌برند. بعدها آشکار شد که این افسردگی عمده نیست و نشانگان افت روحیه است. هم چنانکه این وضع به عنوان یک حالت بی‌قراری توصیف شد که می‌تواند در پاسخ به شرایط خارجی تغییر یابد.
چنگ یانگ لی و همکاران[۱۸۴] (۲۰۱۱) در مطالعه‌ای توصیفی با عنوان «علائم نشانگان افت روحیه در میان بیماران سرطانی در تایوان» مطرح می‌کند که متغیر نشانگان افت روحیه با وضعیت اجتماعی اقتصادی، مشکلات روان‌شناختی، انواع گوناگون بیماری‌ها، سرطان و درمان‌ها مرتبط است.
رندی سانسون[۱۸۵] (۲۰۱۰) در مطالعهای تحت عنوان «نشانگان افت روحیه در افراد مبتلا به بیماریهای جسمانی» بیان نموده است که نشانگان افت روحیه حالت بی‌قراری چه در جمعیت بالینی چه در جمعیت روان‌پزشکی است و با حس عدم قدرت و پوچی مشخص می‌شود. به خاطر شیوع آن در یک سوم جمعیت بیمار گفته‌شده شناسایی این سندرم و انجام مداخلات ضروری ست.
بوسگالیا و کلارک[۱۸۶]،(۲۰۰۷) در مطالعهای با عنوان «حس انسجام به عنوان یک عامل نگه‌دارنده برای نشانگان افت روحیه در زنانی با تشخیص نهایی سرطان رحم» به این نتیجه رسیده است که حس انسجام می‌تواند در مقابل نشانگان افت روحیه حمایتگر باشد.
مطالعات انجام‌شده خارج از کشور در زمینه شناختدرمانی هستینگر:
لی می و ویلسون (٢٠٠٨) در مطالعه مروری مداخلات مرتبط با درمان آزردگی وجودی در ارتباط با بیماری‌های تهدیدکننده زندگی، نشان دادند که هدف کلی مداخلاتی مثل گروه درمانی حمایتی-بیانگر[۱۸۷]، گروه درمانی شناختی-وجودی، روان‌درمانی گروهی متمرکز بر معنا[۱۸۸] و مداخلات معنا محور[۱۸۹] و غیره ایجاد فضایی حمایتی برای کمک به آن‌ ها جهت سازگاری با نیازهای بیماری و ارتقای کیفیت زندگی‌شان و مقابله با منابع فشار روانی ناشی از سرطان و یافتن معنای شخصی‌شان و پاسخ به سؤالات وجودی بیماران مبتلا بوده است و علی‌رغم وجود برخی محدودیت‌ها تا حدودی در تخفیف آلام وجودی این بیماران موثر بوده‌اند لیکن تنها به نیازهای بیماران پرداخته‌اند.
کیسان، بلاچ، اسمیت، کلارک، میاچ، اِکین، رنجری و اسنایدر (۲۰۰۳) در مطالعه‌ای تحت عنوان«اثربخشی روش گروه درمانی شناختی وجود گرا بر بهبود وضعیت خلق و نگرش ذهنی زنان مبتلا به مراحل غیر منتشر سرطان که مشغول دریافت شیمی‌درمانی بودند» به این نتیجه رسیدند که شیوه گروه درمانی وجودگرا باعث کاهش اضطراب و افسردگی و بهتر شدن روابط خانوادگی بیماران شد و در مجموع این روش را مفید ارزیابی کردند.
بریتبارت (۲۰۰۳) در مطالعهای تحت عنوان اثربخشی گروه درمانی وجودی در مداخلات درمانی افراد مبتلا به سرطان بیان کرد؛ در گروههایی که افراد درگیر بیماریهای مزمن میگردند، به مرور زمان معنا و امید خود را از دست داده و دچار افسردگی میگردند. لذا درمانهای وجودی برای کاهش افسردگی و افزایش امید این دسته از بیماران یکی از مناسبترین شیوه های درمانی است.
مطالعات رواندرمانی انجام‌شده در خارج از کشور:
اسکویلی [۱۹۰]و همکاران (۲۰۱۲) در مطالعه‌ای تأثیر امید در سلامتی بیماران مبتلا به ایدز را مورد بررسی قرار دارند . آن‌ ها با بهره گرفتن از مقیاس خود گزارشی بعلاوهی آزمایش نمونه خون بیماران مبتلا به ایدز، میزان سلامتی آن‌ ها را پس از امید درمانی ارزیابی کرده و به این نتیجه رسیدند که افزایش امید منجر به افزایش سلامتی در این بیماران می‌گردد.
بلیر[۱۹۱](۲۰۰۴) در تحقیقی تحت عنوان بررسی تأثیر امیدواری در گروه درمانی نشان داد که امیدواری که نوعی احساس امکان‌پذیر بود، یک رویداد یا رفتار مطلوب در آینده است، عامل مهم در روان‌درمانگری فردی و گروه درمانی به حساب می‌آید.< br />فصل سوم
روش تحقیق
۳-۱ مقدمه
در این فصل نوع مطالعه، جامعه مورد بررسی، ملاکهای انتخاب شرکت‌کنندگان در پژوهش، حجم نمونه و روش محاسبه آن، متغیرهای پژوهش و نحوه سنجش آن‌ ها، روش جمع‌ آوری داده ها و تجزیه و تحلیل آن‌ ها، شیوه انجام کار و ملاحظات اخلاقی به تفضیل مطرح شده است. همچنین سرفصل محتوای جلسات درمانی در انتهای فصل به اختصار بیان شده است.
۳-۲ روش مطالعه
در این پژوهش از طرح تک موردی[۱۹۲]استفاده شده است. یک آزمایش تک موردی که گاهی آن را آزمایش تک آزمودنی[۱۹۳] یا آزمایش سریهای زمانی[۱۹۴] نامیده‌اند، آزمایشی است که مشتمل بر تحقیق فشرده بر روی یک فرد یا تعدادی از افراد است که به عنوان یک گروه واحد در نظر گرفته میشوند. همان طور که توماس کراتوچویل توضیح داده است، طرحهای تک موردی «مشتمل بر تحلیل فشرده در ارگانیزم های واحد» است. آزمایشهای تک موردی به خوبی متناسب با پژوهشهای اصلاح رفتار است که در مشاوره، روان‌درمانی، مراقبتهای درمانگاهی و پژوهشهای مربوط به مواد مخدر به وفور یافت میشود (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
آزمایشهای تک موردی را نباید با پژوهش موردی[۱۹۵] معادل دانست. هرچند هر دو به مورد معطوف‌اند، ولی از نظر طرح و هدف با یکدیگر تفاوت زیادی دارند. پژوهشهای موردی به یک عمل آزمایشی وسیعتر (معمولاً یک برنامه به مقیاس بزرگ) میپردازد که در یک موقعیت میدانی اجراشده و به شدت بر داده‌های کیفی تکیه دارد (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
در این مطالعه از طرح AB که مبنای طرحهای تک آزمودنی است، استفاده شد. پژوهشگر این طرح را از طریق انتخاب یک شرکت‌کننده برای آزمایش، یک یا چند رفتار هدف، اندازه های رفتارهای هدف و یک عمل آزمایشی شروع میکند. سپس رفتار هدف به طور مکرر در خلال دوره خط پایه اندازه گیری میشود (A). سرانجام عمل آزمایشی (B) هنگامی که پژوهشگر به اندازه گیری رفتار هدف ادامه میدهد، اجرا میگردد.
اگر تفاوت بین میانگین اندازهگیریهای A و B از نظر آماری معنادار باشد، میتوانیم نتیجه بگیریم که یک تغییر پایا از مرحله خط پایه تا مرحله عمل اتفاق افتاده است. این طرح فقط باید هنگامی مورد استفاده قرار گیرد که هیچ جانشین مناسبی موجود نباشد یا اینکه پژوهشگر آن را به عنوان یک مطالعه مقدماتی انجام دهد تا به دنبال آن آزمایشی با طرحی دقیقتر اجرا کند (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶).
به عنوان یک قاعده کلی، در هر مرحله از یک طرح تک موردی باید طول و تعداد اندازه گیری‌ها تقریباً مساوی باشد، در غیر این صورت، عدم تعادل، تحلیل آماری و تفسیر اثرهای عمل آزمایشی را پیچیده میکند (گال، بورگ و گال،٢٠٠۵؛ ترجمه نصر و همکاران، ١٣٨۶). با وجود محدودیتهای این طرح در مقایسه با بقیه طرحها، از تاریخچه های موردی غیرآزمایشی درباره اثرات درمان، شواهد بهتری ارائه میکند (بیابان‌گرد،١٣٨۶).

موضوعات: بدون موضوع  لینک ثابت
 [ 02:52:00 ب.ظ ]